TkA05G425840 | RubberDandelionOmics

Gene overview

TkA05G425840

Reference: TK1151 Chr: Chr05 Coordinates: 106198831-106201426 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2130 bp · TkA05G425840|TK1151|cDNA

ATCTACCTCATAGTTAACCACAATGGCACTTGTGTTCACCACCTCTTTACTCACCTTCTTGCTTTTAGTTTCAAGTTTGGGTTATTTAGCTCATGCTAAGACTCACTCCCATGACTTTGTCGTTCAAGAAACAAAAGTTAAAAGGCTATGCAAGACCCATAATTCGATCACGGTCAACGGGCAGTTCCCTGGTCCGACGCTAGAAGTCAACAATGGCGATAGTTTAGTTATACGCGTTGTCAACAAAGCTAGATATAATG...

CDS

Download CDS FASTA

1713 bp · TkA05G425840|TK1151|CDS

ATGGCACTTGTGTTCACCACCTCTTTACTCACCTTCTTGCTTTTAGTTTCAAGTTTGGGTTATTTAGCTCATGCTAAGACTCACTCCCATGACTTTGTCGTTCAAGAAACAAAAGTTAAAAGGCTATGCAAGACCCATAATTCGATCACGGTCAACGGGCAGTTCCCTGGTCCGACGCTAGAAGTCAACAATGGCGATAGTTTAGTTATACGCGTTGTCAACAAAGCTAGATATAATGTCACGATTCATTGGCACGGTGT...

Protein

Download Protein FASTA

570 aa · TkA05G425840|TK1151|PROTEIN

MALVFTTSLLTFLLLVSSLGYLAHAKTHSHDFVVQETKVKRLCKTHNSITVNGQFPGPTLEVNNGDSLVIRVVNKARYNVTIHWHGVRQITTGWADGPEFITQCPIRPGGSYTYRFTISGQEGTLWWHAHSSWVRATVYGAIVIHPRQGETYPFPKPKRDSVIVLGEWWDANPIDVIREATRTGAAPNISDAYTINGQPGDLYKCSSKDTVIVPIDSGETNLIRVINAALNQQLFFTIANHKLTVVGADASYVKPFTTSV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G425840`
TK1151 ID	TkA05G425840
OH-1004 ID	LXL04_035106
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	82.100
Protein coverage (%)	TK1151 99.123 / OH-1004 99.288 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G425840

Location Chr05:106198831-106201426 (+)

Description Similar to LAC12: Laccase-12

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g05390`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release
`At2g40370`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os11g0108700`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release
`Os01g0827300`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release
`Os12g0108000`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035106 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0046274 lignin catabolic process Biological Process

GO:0046688 response to copper ion Biological Process

GO:1990641 response to iron ion starvation Biological Process

GO:0005576 extracellular region Cellular Component

GO:0048046 apoplast Cellular Component

GO:0048226 Casparian strip Cellular Component

GO:0005507 copper ion binding Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

GO:0052716 hydroquinone:oxygen oxidoreductase activity Molecular Function

KEGG gene cross-reference

ath:AT2G40370

ath:AT5G05390

dosa:Os01g0827300

dosa:Os11g0108700

dosa:Os12g0108000

osa:4349566

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.957

Rank 1 · TkA05G425840 · TK1151

Cytoplasm0.021

Rank 2 · TkA05G425840 · TK1151

Cell membrane0.019

Rank 3 · TkA05G425840 · TK1151

Endoplasmic reticulum0.013

Rank 4 · TkA05G425840 · TK1151

Golgi apparatus0.008

Rank 5 · TkA05G425840 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07732Cu-oxidase_334-148 aa

PF00394Cu-oxidase36-76 aa

PF07731Cu-oxidase_255-130 aa

PF05899Cupin_357-77 aa

PF07731Cu-oxidase_2128-164 aa

PF00394Cu-oxidase161-309 aa

PF29646YxzG182-241 aa

PF07732Cu-oxidase_3193-214 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G425840	`PF07732`	Cu-oxidase_3	34	148	3.8e-44	150.3
TkA05G425840	`PF00394`	Cu-oxidase	36	76	1.2e-44	152.9
TkA05G425840	`PF07731`	Cu-oxidase_2	55	130	1.7e-46	158.1
TkA05G425840	`PF05899`	Cupin_3	57	77	0.066	13.6
TkA05G425840	`PF07731`	Cu-oxidase_2	128	164	1.7e-46	158.1
TkA05G425840	`PF00394`	Cu-oxidase	161	309	1.2e-44	152.9
TkA05G425840	`PF29646`	YxzG	182	241	0.053	14.4
TkA05G425840	`PF07732`	Cu-oxidase_3	193	214	3.8e-44	150.3
TkA05G425840	`PF07731`	Cu-oxidase_2	250	278	1.7e-46	158.1
TkA05G425840	`PF07732`	Cu-oxidase_3	412	436	3.8e-44	150.3
TkA05G425840	`PF07731`	Cu-oxidase_2	419	552	1.7e-46	158.1
TkA05G425840	`PF05899`	Cupin_3	431	494	0.066	13.6
TkA05G425840	`PF07732`	Cu-oxidase_3	457	478	3.8e-44	150.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FLB5`	Arabidopsis thaliana	sp\|Q9FLB5\|LAC12_ARATH Laccase-12	76.200%	Swiss-Prot	High
`Q9SIY8`	Arabidopsis thaliana	sp\|Q9SIY8\|LAC5_ARATH Laccase-5	73.000%	Swiss-Prot	High
`Q2RBK2`	Oryza sativa subsp. japonica	sp\|Q2RBK2\|LAC17_ORYSJ Putative laccase-17	68.300%	Swiss-Prot	High
`Q941X2`	Oryza sativa subsp. japonica	sp\|Q941X2\|LAC3_ORYSJ Laccase-3	67.700%	Swiss-Prot	High
`Q2QYS3`	Oryza sativa subsp. japonica	sp\|Q2QYS3\|LAC23_ORYSJ Laccase-23	68.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card