RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA05G338170
Reference: TK1151 Chr: Chr05 Coordinates: 83585241-83586235 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

546 bp · TkA05G338170|TK1151|cDNA

ATGACATTCCGCAACCGCAACCAAAACCGCACCGCAAAACCGAAACCGCACCGCAAAATTTCGACCGCCGACGGCGTCAATCGCTCATCGCGAACACTCAGCAACCGCCGGCTCACTCCTTGTCTCCCTCCTGTCGTCAATCGCTCATCACGAACACTCAGCAACCGCCGACGCCGTCAATCGCTCACCAGCGACCCTCAGTCCCTCACCGGCTCACTCCTTGTCTCCCTCCTGTCGTCAATCGCTCATCGCGAACACTC...

CDS

Download CDS FASTA

546 bp · TkA05G338170|TK1151|CDS

ATGACATTCCGCAACCGCAACCAAAACCGCACCGCAAAACCGAAACCGCACCGCAAAATTTCGACCGCCGACGGCGTCAATCGCTCATCGCGAACACTCAGCAACCGCCGGCTCACTCCTTGTCTCCCTCCTGTCGTCAATCGCTCATCACGAACACTCAGCAACCGCCGACGCCGTCAATCGCTCACCAGCGACCCTCAGTCCCTCACCGGCTCACTCCTTGTCTCCCTCCTGTCGTCAATCGCTCATCGCGAACACTC...

Protein

Download Protein FASTA

181 aa · TkA05G338170|TK1151|PROTEIN

MTFRNRNQNRTAKPKPHRKISTADGVNRSSRTLSNRRLTPCLPPVVNRSSRTLSNRRRRQSLTSDPQSLTGSLLVSLLSSIAHREHSATADAVNRSPATLSPSPGHSLSPSCRPSRFTPPSSARLATADNTYADSQNTYPVSSLLVSLKGIGIRMVKRLISIHLVTMELESEWNLSEEYRG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA05G338170
TK1151 IDTkA05G338170
OH-1004 IDLXL04_035367
Relationship / confidenceNon Reciprocal Best Hit / Complex relationship
Protein identity (%)89.300
Protein coverage (%)TK1151 98.343 / OH-1004 40.878
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA05G338170
LocationChr05:83585241-83586235 (-)
DescriptionSimilar to VHA-d1: V-type proton ATPase subunit d1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_035367 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006879 intracellular iron ion homeostasis Biological Process
GO:0007034 vacuolar transport Biological Process
GO:0007035 vacuolar acidification Biological Process
GO:0036295 cellular response to increased oxygen levels Biological Process
GO:1902600 proton transmembrane transport Biological Process
GO:0000220 vacuolar proton-transporting V-type ATPase, V0 domain Cellular Component
GO:0000325 plant-type vacuole Cellular Component
GO:0005765 lysosomal membrane Cellular Component
GO:0005769 early endosome Cellular Component
GO:0005773 vacuole Cellular Component
GO:0005774 vacuolar membrane Cellular Component
GO:0005794 Golgi apparatus Cellular Component
KEGG gene cross-reference
ath:AT3G28710
ath:AT3G28715
ddi:DDB_G0273071
ddi:DDB_G0273657
dme:Dmel_CG2934
dosa:Os01g0587000
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.506
Rank 1 · TkA05G338170 · TK1151
Cytoplasm0.442
Rank 2 · TkA05G338170 · TK1151
Cell membrane0.083
Rank 3 · TkA05G338170 · TK1151
Mitochondrion0.077
Rank 4 · TkA05G338170 · TK1151
Endoplasmic reticulum0.049
Rank 5 · TkA05G338170 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser