TkA05G312730 | RubberDandelionOmics

Gene overview

TkA05G312730

Reference: TK1151 Chr: Chr05 Coordinates: 77171279-77176934 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA No cDNA sequence available

cDNA

No cDNA sequence is available for this reference.

CDS

Download CDS FASTA

2547 bp · TkA05G312730|TK1151|CDS

ATGGAGACGCAGTCGTTAAGTCTTCGTGTGGTGTTCGAAAATCGTTCGGTTCTTAGCCAAACACAGCGCTCCGACGGTATGAACCAGAGCTGGCTTTTAATTGAGCCACAGCATCATCCAAAAATCTCCGACGTCTGCAATCATCTTCTTCACGTTTTCAACCTTCGTCGCTCGTGCCCTAATGGAATCCTCCTCTATATGAAAGGCTTTGTATTACCCCCATCAGAGTCAACTCGAATCTTGAAGAACAAGGAAATTCT...

Protein

Download Protein FASTA

848 aa · TkA05G312730|TK1151|PROTEIN

METQSLSLRVVFENRSVLSQTQRSDGMNQSWLLIEPQHHPKISDVCNHLLHVFNLRRSCPNGILLYMKGFVLPPSESTRILKNKEILCVKRKEMALAQGMEKKSEDKPLPIETVSKKRKASLELRSPKSEENQGGFPTPDEAKKGPSRNAVRKRAKRQWAKKTKVSKKISQEHQENVADLETNDKNKYARKDVKRKQTHEGYVWWDHFNLFVNKKGEYISSCKYCGKKNSSGIETYDTSALLDHLSQCPLYPKNKELAFQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G312730`
TK1151 ID	TkA05G312730
OH-1004 ID	LXL04_020812
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.800
Protein coverage (%)	TK1151 100.000 / OH-1004 93.209 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G312730

Location Chr05:77171279-77176934 (+)

Description Similar to Os03g0733400: Zinc finger BED domain-containing protein RICESLEEPER 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g42170`	Transposase-like protein that is essential for plant growth and development.	No verified direct reference in this release
`At1g13030`	Probable component of nuclear coiled bodies, also known as Cajal bodies or CBs, which are involved in the modification and assembly of nucleoplasmic snRNPs (Probable).	A distant coilin homologue is required for the formation of cajal bodies in Arabidopsis.2006 · DOI: 10.1091/mbc.e05-12-1157

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0733400`	Transposase-like protein that is essential for plant growth and development.	No verified direct reference in this release
`Os05g0239150`	Transposase-like protein that is essential for plant growth and development.	No verified direct reference in this release
`Os05g0583200`	Transposase-like protein that is essential for plant growth and development.	No verified direct reference in this release
`Os01g0518400`	Transposase-like protein that is essential for plant growth and development.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020812 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006310 DNA recombination Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0032196 transposition Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0046983 protein dimerization activity Molecular Function

KEGG gene cross-reference

ath:AT3G42170

dosa:Os03g0733400

dosa:Os05g0239150

dosa:Os05g0583200

osa:4339741

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.941

Rank 1 · TkA05G312730 · TK1151

Cytoplasm0.104

Rank 2 · TkA05G312730 · TK1151

Cell membrane0.016

Rank 3 · TkA05G312730 · TK1151

Mitochondrion0.013

Rank 4 · TkA05G312730 · TK1151

Endoplasmic reticulum0.010

Rank 5 · TkA05G312730 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15862Coilin_N20-197 aa

PF27039ZBED1_RNase-like_helical157-187 aa

PF02892zf-BED205-246 aa

PF27041ZBED1_RNase-like350-436 aa

PF26742DUF8247361-402 aa

PF15862Coilin_N434-457 aa

PF27039ZBED1_RNase-like_helical447-561 aa

PF02892zf-BED565-579 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G312730	`PF15862`	Coilin_N	20	197	6.2e-09	36.6
TkA05G312730	`PF27039`	ZBED1_RNase-like_helical	157	187	3.5e-22	79.3
TkA05G312730	`PF02892`	zf-BED	205	246	0.0069	17.1
TkA05G312730	`PF27041`	ZBED1_RNase-like	350	436	1.3e-22	80.4
TkA05G312730	`PF26742`	DUF8247	361	402	0.012	16.3
TkA05G312730	`PF15862`	Coilin_N	434	457	6.2e-09	36.6
TkA05G312730	`PF27039`	ZBED1_RNase-like_helical	447	561	3.5e-22	79.3
TkA05G312730	`PF02892`	zf-BED	565	579	0.0069	17.1
TkA05G312730	`PF14372`	hAT-like_RNase-H	584	679	1.1e-15	58.4
TkA05G312730	`PF05699`	Dimer_Tnp_hAT	728	810	1.6e-27	95.8
TkA05G312730	`PF02892`	zf-BED	793	806	0.0069	17.1
TkA05G312730	`PF27039`	ZBED1_RNase-like_helical	800	823	3.5e-22	79.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M2N5`	Arabidopsis thaliana	sp\|Q9M2N5\|DSLE_ARATH Zinc finger BED domain-containing protein DAYSLEEPER	29.300%	Swiss-Prot	Low
`Q8RWK8`	Arabidopsis thaliana	sp\|Q8RWK8\|COIL_ARATH Coilin	35.700%	Swiss-Prot	Medium
`Q6AVI0`	Oryza sativa subsp. japonica	sp\|Q6AVI0\|RSLE2_ORYSJ Zinc finger BED domain-containing protein RICESLEEPER 2	31.600%	Swiss-Prot	Medium
`B9FJG3`	Oryza sativa subsp. japonica	sp\|B9FJG3\|RSLE1_ORYSJ Zinc finger BED domain-containing protein RICESLEEPER 1	30.900%	Swiss-Prot	Medium
`Q75HY5`	Oryza sativa subsp. japonica	sp\|Q75HY5\|RSLE3_ORYSJ Zinc finger BED domain-containing protein RICESLEEPER 3	29.200%	Swiss-Prot	Low
`Q0JMB2`	Oryza sativa subsp. japonica	sp\|Q0JMB2\|RSLE4_ORYSJ Zinc finger BED domain-containing protein RICESLEEPER 4	29.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card