TkA05G281690 | RubberDandelionOmics

Gene overview

TkA05G281690

Reference: TK1151 Chr: Chr05 Coordinates: 69595921-69599883 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1155 bp · TkA05G281690|TK1151|cDNA

ATGAGTACCGCTTATCACCCACAGACGGATGGTCAGAGTAAGAGAACCATCCAGACGTTGGAAGACATGCTCCGCGCGTGTGTGATAGACTTCGGAAGCTCATGGGATACCCACCTACCCTTAATCGAATTCTCCTACAACAACAGTTATCACACTACCATTAAAGCAGCACCATTTGAAGCTTTATATGGACGAAAGTGTCGATCACCTGTGTGTTGGGCTGAAGTGGGCGATACCCAATTAGCCCGATCTCAGGTAAG...

CDS

Download CDS FASTA

1155 bp · TkA05G281690|TK1151|CDS

ATGAGTACCGCTTATCACCCACAGACGGATGGTCAGAGTAAGAGAACCATCCAGACGTTGGAAGACATGCTCCGCGCGTGTGTGATAGACTTCGGAAGCTCATGGGATACCCACCTACCCTTAATCGAATTCTCCTACAACAACAGTTATCACACTACCATTAAAGCAGCACCATTTGAAGCTTTATATGGACGAAAGTGTCGATCACCTGTGTGTTGGGCTGAAGTGGGCGATACCCAATTAGCCCGATCTCAGGTAAG...

Protein

Download Protein FASTA

384 aa · TkA05G281690|TK1151|PROTEIN

MSTAYHPQTDGQSKRTIQTLEDMLRACVIDFGSSWDTHLPLIEFSYNNSYHTTIKAAPFEALYGRKCRSPVCWAEVGDTQLARSQVSDNTLTGPEIIRETTEKIVQIRERMKTARDRQKSYVDKRRKPLEFQVGDLVLLKVNEKLNFVEEPVEIMDREVKRLKQSRIPIVNVRWSAKRGPEFTWEREDQMKLKYLIFSLTLRKPLQTPLSHSSPTQRHNLPELAHTLSSIPVSYAFPTFPPTPLYLRWVCNGSSKYTYVT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G281690`
TK1151 ID	TkA05G281690
OH-1004 ID	LXL04_004182
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	68.600
Protein coverage (%)	TK1151 53.125 / OH-1004 62.387 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G281690

Location Chr05:69595921-69599883 (+)

Description Similar to TY3B-I: Transposon Ty3-I Gag-Pol polyprotein (Saccharomyces cerevisiae (strain ATCC 204508 / S288c)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g36490`	Required for transport of secretory proteins from the Golgi complex (By similarity).	Identification of two phosphatidylinositol/phosphatidylcholine transfer protein genes that are predominately transcribed in the flowers of Arabidopsis thaliana.2007 · DOI: 10.1016/j.jplph.2006.03.014
`At2g18180`	Required for transport of secretory proteins from the Golgi complex.	No verified direct reference in this release
`At4g39180`	Required for transport of secretory proteins from the Golgi complex (By similarity).	No verified direct reference in this release
`At2g21540`	Required for transport of secretory proteins from the Golgi complex (By similarity).	Identification of two phosphatidylinositol/phosphatidylcholine transfer protein genes that are predominately transcribed in the flowers of Arabidopsis thaliana.2007 · DOI: 10.1016/j.jplph.2006.03.014
`At4g39170`	Required for transport of secretory proteins from the Golgi complex.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004182 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006310 DNA recombination Biological Process

GO:0006508 proteolysis Biological Process

GO:0015074 DNA integration Biological Process

GO:0075523 viral translational frameshifting Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003723 RNA binding Molecular Function

GO:0003887 DNA-directed DNA polymerase activity Molecular Function

GO:0003964 RNA-directed DNA polymerase activity Molecular Function

GO:0004190 aspartic-type endopeptidase activity Molecular Function

GO:0004519 endonuclease activity Molecular Function

KEGG gene cross-reference

sce:YGR109W-B

sce:YIL082W-A

spo:2542672

spo:2542797

spo:2543673

spo:3361218

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.445

Rank 1 · TkA05G281690 · TK1151

Cytoplasm0.400

Rank 2 · TkA05G281690 · TK1151

Mitochondrion0.143

Rank 3 · TkA05G281690 · TK1151

Cell membrane0.059

Rank 4 · TkA05G281690 · TK1151

Endoplasmic reticulum0.049

Rank 5 · TkA05G281690 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94A34`	Arabidopsis thaliana	sp\|Q94A34\|SFH12_ARATH Phosphatidylinositol/phosphatidylcholine transfer protein SFH12	68.400%	Swiss-Prot	Low
`Q9SI13`	Arabidopsis thaliana	sp\|Q9SI13\|SFH10_ARATH Phosphatidylinositol/phosphatidylcholine transfer protein SFH10	68.400%	Swiss-Prot	Low
`F4JVA9`	Arabidopsis thaliana	sp\|F4JVA9\|SFH2_ARATH Phosphatidylinositol/phosphatidylcholine transfer protein SFH2	64.500%	Swiss-Prot	Low
`Q93ZE9`	Arabidopsis thaliana	sp\|Q93ZE9\|SFH3_ARATH Phosphatidylinositol/phosphatidylcholine transfer protein SFH3	64.500%	Swiss-Prot	Low
`F4JVA6`	Arabidopsis thaliana	sp\|F4JVA6\|SFH6_ARATH Phosphatidylinositol/phosphatidylcholine transfer protein SFH6	62.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card