TkA05G137870 | RubberDandelionOmics

Gene overview

TkA05G137870

Reference: TK1151 Chr: Chr05 Coordinates: 35921595-35925230 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1479 bp · TkA05G137870|TK1151|cDNA

ATGAACGGTTACACCTTCTTTCTCAAGCATATGAAGAGTGATGCACTCTTCCCAAAGCGTATGAATGGAGTCCATTGGTATCTAGAGGCGTATGAACACTCCTTGTTCATGCCGGTGGCGTATGAAAGCATAACCAAGCTTTCCCAAGCGTATGAAGGATGCATCTTGGTTGTTTTTTCTTCTAGTGAAGAACGTCGAGGCTGCTCTAGGGGGCGAAGCTACACTTACACTCACTCAGGACGATCTCCTGATGATGAAGG...

CDS

Download CDS FASTA

1479 bp · TkA05G137870|TK1151|CDS

ATGAACGGTTACACCTTCTTTCTCAAGCATATGAAGAGTGATGCACTCTTCCCAAAGCGTATGAATGGAGTCCATTGGTATCTAGAGGCGTATGAACACTCCTTGTTCATGCCGGTGGCGTATGAAAGCATAACCAAGCTTTCCCAAGCGTATGAAGGATGCATCTTGGTTGTTTTTTCTTCTAGTGAAGAACGTCGAGGCTGCTCTAGGGGGCGAAGCTACACTTACACTCACTCAGGACGATCTCCTGATGATGAAGG...

Protein

Download Protein FASTA

492 aa · TkA05G137870|TK1151|PROTEIN

MNGYTFFLKHMKSDALFPKRMNGVHWYLEAYEHSLFMPVAYESITKLSQAYEGCILVVFSSSEERRGCSRGRSYTYTHSGRSPDDEGRSYGHFGVKLCHSLDVFDLVEDCASAHETWNTLHQHFAGTEAAKDKKMASVVNAFSNFKALPNECLQDTFKRFKFCVFRLKNSENEKSNLEIKLKFINSLGESWITVQMIIQGFGTLRKMSLYELFNDLQAQESTVLSNSVRSGGPIALISNSADIMGATSDHASHQTRAKTQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G137870`
TK1151 ID	TkA05G137870
OH-1004 ID	LXL04_034445
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	78.300
Protein coverage (%)	TK1151 63.618 / OH-1004 73.872 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G137870`
Location	Chr05:35921595-35925230 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_034445` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.490

Rank 1 · TkA05G137870 · TK1151

Cytoplasm0.468

Rank 2 · TkA05G137870 · TK1151

Endoplasmic reticulum0.062

Rank 3 · TkA05G137870 · TK1151

Cell membrane0.061

Rank 4 · TkA05G137870 · TK1151

Mitochondrion0.059

Rank 5 · TkA05G137870 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14223Retrotran_gag_2102-223 aa

PF20160C-JID147-190 aa

PF12353eIF3g247-285 aa

PF29089Protamine-3247-282 aa

PF11521TFIIE-A_C248-286 aa

PF04889Cwf_Cwc_15251-288 aa

PF27116YjiV_N256-355 aa

PF12353eIF3g331-366 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G137870	`PF14223`	Retrotran_gag_2	102	223	1.9e-09	38.3
TkA05G137870	`PF20160`	C-JID	147	190	0.18	12.9
TkA05G137870	`PF12353`	eIF3g	247	285	0.4	11.6
TkA05G137870	`PF29089`	Protamine-3	247	282	0.48	11.3
TkA05G137870	`PF11521`	TFIIE-A_C	248	286	1.7	9.8
TkA05G137870	`PF04889`	Cwf_Cwc_15	251	288	0.83	10.2
TkA05G137870	`PF27116`	YjiV_N	256	355	0.21	13.0
TkA05G137870	`PF12353`	eIF3g	331	366	0.4	11.6
TkA05G137870	`PF00098`	zf-CCHC	349	364	0.00074	20.2
TkA05G137870	`PF04889`	Cwf_Cwc_15	375	427	0.83	10.2
TkA05G137870	`PF14223`	Retrotran_gag_2	383	407	1.9e-09	38.3
TkA05G137870	`PF27116`	YjiV_N	383	416	0.21	13.0
TkA05G137870	`PF11521`	TFIIE-A_C	387	435	1.7	9.8
TkA05G137870	`PF29089`	Protamine-3	405	416	0.48	11.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card