TkA05G083280 | RubberDandelionOmics

Gene overview

TkA05G083280

Reference: TK1151 Chr: Chr05 Coordinates: 22575084-22579055 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1552 bp · TkA05G083280|TK1151|cDNA

CATTTCTAAGTCCATAGTATAAAAAGTTGGATCTGCTCGACGGGACAAATCTCCGGCGAAGCTCAGTTAAACTAAGTCCATAATTCCTGGATTTCTCATTTCTTCCCTATTTCGGTGAATTCGTGAATGGAAACGATCAGAAAACAGGCGACGAAGCTCCGGGAGCAGGTTGCCAGACAACAGCAGGCGGTTTTCAAGCAGTTTGGTGGTGGGGGCTATGGAGGTTCTGATAATCTTGTTACAGATGAGGCAGAATTGAG...

CDS

Download CDS FASTA

1113 bp · TkA05G083280|TK1151|CDS

ATGGAAACGATCAGAAAACAGGCGACGAAGCTCCGGGAGCAGGTTGCCAGACAACAGCAGGCGGTTTTCAAGCAGTTTGGTGGTGGGGGCTATGGAGGTTCTGATAATCTTGTTACAGATGAGGCAGAATTGAGGCTTCATCAGAAACTTGAAAAGTTATACATATCTACACGTGCTGCCAAGCATTTCCAAAGGGACATTGTTCGTGGTGTTGAAGGATATATAGTTACCGGTTCCAAACAAGTTGAAATCGGGACAAA...

Protein

Download Protein FASTA

370 aa · TkA05G083280|TK1151|PROTEIN

METIRKQATKLREQVARQQQAVFKQFGGGGYGGSDNLVTDEAELRLHQKLEKLYISTRAAKHFQRDIVRGVEGYIVTGSKQVEIGTKLSEDSRKYGVENTCTSGSTLSRAAKNFSRARALKEKERGNLLKSFGTQVAEPLRAMVMGAPLEDARHLAQRYDRMRQEAEAQAVEVSKRQARVREGTGNPDILTKLEASESKLQDLKSNMAVLGREAASAMAAVEGQQQKMTLQRLISMVESERAYHQKVLQILDQLEGEMVS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G083280`
TK1151 ID	TkA05G083280
OH-1004 ID	LXL04_019754
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G083280

Location Chr05:22575084-22579055 (+)

Description Similar to SH3P2: SH3 domain-containing protein 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g34660`	May regulate autophagosome formation or maturation.	A BAR-domain protein SH3P2, which binds to phosphatidylinositol 3-phosphate and ATG8, regulates autophagosome formation in Arabidopsis.2013 · DOI: 10.1105/tpc.113.118307 SH3 Domain-Containing Protein 2 Plays a Crucial Role at the Step of Membrane Tubulation during Cell Plate Formation.2017 · DOI: 10.1105/tpc.17.00108
`At4g18060`	May be involved in the recruitment of DRP2A to the accessory protein complex and in the negative regulation of its GTPase activity.	No verified direct reference in this release
`At1g31440`	Lipid binding protein bound strongly to phosphatidic acid, phosphatidylinositol-4-phosphate and phosphatidylinositol-4,5- bisphosphate.	Role of SH3 domain-containing proteins in clathrin-mediated vesicle trafficking in Arabidopsis.2001 · DOI: 10.1105/tpc.010279

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019754 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006897 endocytosis Biological Process

GO:0007165 signal transduction Biological Process

GO:0009920 cell plate formation involved in plant-type cell wall biogenesis Biological Process

GO:0061024 membrane organization Biological Process

GO:0072319 vesicle uncoating Biological Process

GO:0072583 clathrin-dependent endocytosis Biological Process

GO:1900186 negative regulation of clathrin-dependent endocytosis Biological Process

GO:1903527 positive regulation of membrane tubulation Biological Process

GO:0000421 autophagosome membrane Cellular Component

GO:0001669 acrosomal vesicle Cellular Component

GO:0002102 podosome Cellular Component

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G31440

ath:AT4G18060

ath:AT4G34660

hsa:6455

hsa:6457

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.695

Rank 1 · TkA05G083280 · TK1151

Cell membrane0.238

Rank 2 · TkA05G083280 · TK1151

Nucleus0.184

Rank 3 · TkA05G083280 · TK1151

Golgi apparatus0.131

Rank 4 · TkA05G083280 · TK1151

Lysosome / Vacuole0.080

Rank 5 · TkA05G083280 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10883DUF26816-24 aa

PF30381CEP135_N147-266 aa

PF10883DUF2681150-181 aa

PF05010TACC_C153-182 aa

PF05010TACC_C188-227 aa

PF10883DUF2681221-229 aa

PF14604SH3_9308-356 aa

PF00018SH3_1308-352 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G083280	`PF10883`	DUF2681	6	24	0.41	11.7
TkA05G083280	`PF30381`	CEP135_N	147	266	0.019	14.6
TkA05G083280	`PF10883`	DUF2681	150	181	0.41	11.7
TkA05G083280	`PF05010`	TACC_C	153	182	1.0	9.8
TkA05G083280	`PF05010`	TACC_C	188	227	1.0	9.8
TkA05G083280	`PF10883`	DUF2681	221	229	0.41	11.7
TkA05G083280	`PF14604`	SH3_9	308	356	2.4e-10	40.8
TkA05G083280	`PF00018`	SH3_1	308	352	1.5e-08	34.8
TkA05G083280	`PF07653`	SH3_2	319	355	8.5e-06	26.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VWF1`	Arabidopsis thaliana	sp\|Q8VWF1\|SH3P2_ARATH SH3 domain-containing protein 2	75.700%	Swiss-Prot	High
`Q8L7W0`	Arabidopsis thaliana	sp\|Q8L7W0\|SH3P3_ARATH SH3 domain-containing protein 3	53.600%	Swiss-Prot	High
`Q9C865`	Arabidopsis thaliana	sp\|Q9C865\|SH3P1_ARATH SH3 domain-containing protein 1	52.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card