TkA05G069290 | RubberDandelionOmics

Gene overview

TkA05G069290

Reference: TK1151 Chr: Chr05 Coordinates: 18550518-18553781 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1404 bp · TkA05G069290|TK1151|cDNA

CGCGAGCTTCGGACCACTTCACCGTTCGCTGATTATCAACGACACACCTTCAAAGCTCTCGGAACCCTAACTTCAGCAGATCGATCGATCTGTGCGAAAATCACAAAGCTTTGTTGATTTGCACGAACACAACAATCTAACTCCAATGGCGATGGCTGCACTGAGAAGAGAAGGGAGGCGTTTCGTGCCTCTTGTTTCGTCTCCAAACCCAGTCAATGCGATTCGATCCACCCTTGCTCCCACCGAGGAGCAGTTGGGGC...

CDS

Download CDS FASTA

975 bp · TkA05G069290|TK1151|CDS

ATGGCGATGGCTGCACTGAGAAGAGAAGGGAGGCGTTTCGTGCCTCTTGTTTCGTCTCCAAACCCAGTCAATGCGATTCGATCCACCCTTGCTCCCACCGAGGAGCAGTTGGGGCTTGGGGTTCGGTCCATTTCAACTCAAATTGTTAGAAACCGCATGAAGAGTGTGAAGAACATTCAGAAGATTACAAAGGCCATGAAGATGGTTGCTGCTTCAAAGCTGAGAGCTATTCAAGTGAGAGCCGAAAACTCTCGTGGACT...

Protein

Download Protein FASTA

324 aa · TkA05G069290|TK1151|PROTEIN

MAMAALRREGRRFVPLVSSPNPVNAIRSTLAPTEEQLGLGVRSISTQIVRNRMKSVKNIQKITKAMKMVAASKLRAIQVRAENSRGLWQPFTALLGDTPSVAVKKNVIVTISSDKGLCGGINSTSVKISRALQRINAGPDSEVKYVILGEKAKAQLIRDSKKDISLSMTELQKNFLNYTQVSVLADEILKNVEFDALRIVFNKFQSVVSFLPTTATVLSPEIVERESEAGGKIGSLDAYEIEGGETKSEVLQNLMEFQFS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G069290`
TK1151 ID	TkA05G069290
OH-1004 ID	LXL04_019620
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G069290

Location Chr05:18550518-18553781 (-)

Description Similar to ATPC: ATP synthase subunit gamma, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g33040`	Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019620 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0015986 proton motive force-driven ATP synthesis Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0045259 proton-transporting ATP synthase complex Cellular Component

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT2G33040

dsh:Dshi_2935

jan:Jann_1048

pde:Pden_3817

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.886

Rank 1 · TkA05G069290 · TK1151

Plastid0.067

Rank 2 · TkA05G069290 · TK1151

Cytoplasm0.059

Rank 3 · TkA05G069290 · TK1151

Nucleus0.034

Rank 4 · TkA05G069290 · TK1151

Cell membrane0.014

Rank 5 · TkA05G069290 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00231ATP-synt47-322 aa

PF31104KCTD10_C-like146-203 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G069290	`PF00231`	ATP-synt	47	322	7.5e-75	253.0
TkA05G069290	`PF31104`	KCTD10_C-like	146	203	0.048	14.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q96250`	Arabidopsis thaliana	sp\|Q96250\|ATPG3_ARATH ATP synthase subunit gamma, mitochondrial	79.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card