TkA05G068310 | RubberDandelionOmics

Gene overview

TkA05G068310

Reference: TK1151 Chr: Chr05 Coordinates: 18220554-18223262 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1295 bp · TkA05G068310|TK1151|cDNA

TAGAAAGGCCCAATACGAACAACGTGTTTTATTTGAAGGATTAAACCAACAATTTACACCATAACATCGATCAAAGATTACGAAACAGGAACTGACACCAACACAGAACACCGATCATAGATTTTTTCCATTCCTCCAACCTGAAGATATTAATCAAAATAATTAAGTAGTGGAGGATCGGAATTTGTGATCGGAAATCGTAACGATGCCGCCGAAGAAGATGGGCGTGAACAGCAAATCGGAGGCTGCTAGGGCACGGA...

CDS

Download CDS FASTA

696 bp · TkA05G068310|TK1151|CDS

ATGCCGCCGAAGAAGATGGGCGTGAACAGCAAATCGGAGGCTGCTAGGGCACGGAAGAGCGCCACCGAGGCGGAACGTAAGGAGAAGGACGCGCGTGAGAAGGAGGAGAAGTACTGGCGTGAAGCGGAGGGAGGGAAGTCACGTGCGGCGAAGAAACGCGAGGAGGAATCGGAGAAGAAAGCCGAGGCTGCTGCTCGGAAGGCCGAGGTGCGGCGGCTGGCTGAGATTGAGGAGAAAGAGCTCGAGAAGTCTCTTAAGAA...

Protein

Download Protein FASTA

231 aa · TkA05G068310|TK1151|PROTEIN

MPPKKMGVNSKSEAARARKSATEAERKEKDAREKEEKYWREAEGGKSRAAKKREEESEKKAEAAARKAEVRRLAEIEEKELEKSLKKVDKKATRVSIPVPKVTEAELIRRKEEEQAQILKKAEEDKRKQSRTAKEEEYEKMVLVENTNRDESVIEARSVAEAIAQMSVADSLPVDKHPEKRLKASFKAFEEAELPNLKAEKPGLTHTQYKDMIWKLWKKSPDNPLNQVAEK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G068310`
TK1151 ID	TkA05G068310
OH-1004 ID	LXL04_019607
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.100
Protein coverage (%)	TK1151 99.567 / OH-1004 94.262 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G068310`
Location	Chr05:18220554-18223262 (+)
Description	Similar to ccdc124-a: Coiled-coil domain-containing protein 124-A
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_019607` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006366 transcription by RNA polymerase II Biological Process GO:0051301 cell division Biological Process GO:0005634 nucleus Cellular Component GO:0005813 centrosome Cellular Component GO:0005829 cytosol Cellular Component GO:0005886 plasma membrane Cellular Component GO:0030496 midbody Cellular Component GO:0003713 transcription coactivator activity Molecular Function GO:0003723 RNA binding Molecular Function
KEGG gene cross-reference	bta:510778 ddi:DDB_G0289893 hsa:115098 mmu:234388 xla:447348 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.567

Rank 1 · TkA05G068310 · TK1151

Nucleus0.408

Rank 2 · TkA05G068310 · TK1151

Cell membrane0.096

Rank 3 · TkA05G068310 · TK1151

Endoplasmic reticulum0.033

Rank 4 · TkA05G068310 · TK1151

Golgi apparatus0.032

Rank 5 · TkA05G068310 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06244Ccdc12451-80 aa

PF00342PGI65-129 aa

PF06244Ccdc124114-125 aa

PF06244Ccdc124147-227 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G068310	`PF06244`	Ccdc124	51	80	7e-33	113.5
TkA05G068310	`PF00342`	PGI	65	129	0.2	11.0
TkA05G068310	`PF06244`	Ccdc124	114	125	7e-33	113.5
TkA05G068310	`PF06244`	Ccdc124	147	227	7e-33	113.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card