TkA05G058200 | RubberDandelionOmics

Gene overview

TkA05G058200

Reference: TK1151 Chr: Chr05 Coordinates: 15493245-15499115 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3923 bp · TkA05G058200|TK1151|cDNA

AAAGAACTTCTTCTTCCTTTATCTTCTTTCTCCACCGTTTTTGTTCCAAAAAATAAAATATACATATATAGCCGTTGGATTGAACAAAAGAAAGAAGAAAATAAAAGAACGCCGCGTCTATAGCGTTGCAAGGAGAACGGTCCAGAACGCCAAAGGGGGCCGGGGCGGTGTTGAAACGCTGAGAACGGCGTTCCGCCAGAGCGACGTCCGCGGCGTTGTCCGCGTTTCAACATATGCATGTGTATAATAATGTAGGTTTT...

CDS

Download CDS FASTA

2589 bp · TkA05G058200|TK1151|CDS

ATGACATGTGCAGCTTGTGTTAATTCCATTGAAGGAATCTTAAGAAAGCTTCATGGTGTTAAAAAAGCTGTGGTTGCTCTCACTACTTCACTAGGGGAAGTTGAATATGACCCTTCTATAGTTAGCAAGGATGAAATCATCAATGCTATTGAAGATGCAGGTTTTGAGGCTTCACTTGCACAAAGCAGTGGACAAGACAGAATGATGTTTTTAATAACAGGGATATTAGATCAGTTGGATGAAAATACGTTAGATGGAAT...

Protein

Download Protein FASTA

862 aa · TkA05G058200|TK1151|PROTEIN

MTCAACVNSIEGILRKLHGVKKAVVALTTSLGEVEYDPSIVSKDEIINAIEDAGFEASLAQSSGQDRMMFLITGILDQLDENTLDGILGNLKGVKQFDFNKMTSEVDVLFDSEVLSPRDLVDAIHEESGGDFEVHVKNPHERMITQNLEESSHMLHHFLFSLSLGIPIFALRFICPHIPFLNYLLLSWIGPFQFGDWLRVIMCSLIQFIVGKRFYVAGFRALRRGATNMDVLVAMGTSAAYFYSIYALLYGAVTGFWSMT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G058200`
TK1151 ID	TkA05G058200
OH-1004 ID	LXL04_019530
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.800
Protein coverage (%)	TK1151 100.000 / OH-1004 84.843 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G058200

Location Chr05:15493245-15499115 (+)

Description Similar to RAN1: Copper-transporting ATPase RAN1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g44790`	Involved in copper import into the cell.	No verified direct reference in this release
`At1g63440`	Involved in copper import into the cell.	The Arabidopsis heavy metal P-type ATPase HMA5 interacts with metallochaperones and functions in copper detoxification of roots.2006 · DOI: 10.1111/j.1365-313x.2005.02601.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0665800`	Metal efflux transporter that may play a role in detoxification of heavy metals, such as zinc, copper, lead and cadmium, especially in the shoots.	Rice P1B-type heavy-metal ATPase, OsHMA9, is a metal efflux protein.2007 · DOI: 10.1104/pp.107.102236
`Os02g0196600`	Copper (Cu) transporter that mediates Cu transport in root vacuoles.	A heavy metal P-type ATPase OsHMA4 prevents copper accumulation in rice grain.2016 · DOI: 10.1038/ncomms12138
`Os04g0556000`	Copper (Cu) transporter that plays an essential role in promoting translocation of Cu from roots to shoots.	A member of the heavy metal P-type ATPase OsHMA5 is involved in xylem loading of copper in rice.2013 · DOI: 10.1104/pp.113.226225

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019530 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009636 response to toxic substance Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0010119 regulation of stomatal movement Biological Process

GO:0010273 detoxification of copper ion Biological Process

GO:0046688 response to copper ion Biological Process

GO:0055070 copper ion homeostasis Biological Process

GO:0055085 transmembrane transport Biological Process

GO:0071280 cellular response to copper ion Biological Process

GO:0005768 endosome Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005802 trans-Golgi network Cellular Component

KEGG gene cross-reference

ath:AT1G63440

ath:AT5G44790

dosa:Os04g0556000

dosa:Os06g0665800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.351

Rank 1 · TkA05G058200 · TK1151

Cell membrane0.180

Rank 2 · TkA05G058200 · TK1151

Golgi apparatus0.170

Rank 3 · TkA05G058200 · TK1151

Lysosome / Vacuole0.146

Rank 4 · TkA05G058200 · TK1151

Cytoplasm0.145

Rank 5 · TkA05G058200 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00403HMA1-56 aa

PF00403HMA86-126 aa

PF00122E1-E2_ATPase314-402 aa

PF00702Hydrolase511-750 aa

PF00122E1-E2_ATPase624-636 aa

PF08282Hydrolase_3682-708 aa

PF08282Hydrolase_3725-778 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G058200	`PF00403`	HMA	1	56	1.1e-17	64.9
TkA05G058200	`PF00403`	HMA	86	126	1.1e-17	64.9
TkA05G058200	`PF00122`	E1-E2_ATPase	314	402	3.1e-24	85.4
TkA05G058200	`PF00702`	Hydrolase	511	750	2.2e-28	100.7
TkA05G058200	`PF00122`	E1-E2_ATPase	624	636	3.1e-24	85.4
TkA05G058200	`PF08282`	Hydrolase_3	682	708	0.0002	21.9
TkA05G058200	`PF08282`	Hydrolase_3	725	778	0.0002	21.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9S7J8`	Arabidopsis thaliana	sp\|Q9S7J8\|HMA7_ARATH Copper-transporting ATPase RAN1	68.100%	Swiss-Prot	High
`Q9SH30`	Arabidopsis thaliana	sp\|Q9SH30\|HMA5_ARATH Probable copper-transporting ATPase HMA5	48.600%	Swiss-Prot	Medium
`A0A0P0X004`	Oryza sativa subsp. japonica	sp\|A0A0P0X004\|HMA9_ORYSJ Cation-transporting ATPase HMA5	66.400%	Swiss-Prot	High
`Q6H7M3`	Oryza sativa subsp. japonica	sp\|Q6H7M3\|HMA4_ORYSJ Copper-transporting ATPase HMA4	49.000%	Swiss-Prot	Medium
`A3AWA4`	Oryza sativa subsp. japonica	sp\|A3AWA4\|HMA5_ORYSJ Copper-transporting ATPase HMA5	47.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card