Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2166 bp · TkA05G057900|TK1151|cDNA
CCACAAACCTTTCTTTCATAAATGAACTAAAATTTTAAAGTTTAGTTATTGTTGACCGAGATTATTTTAAACAACAATGGTGGTTGCGTCATGCGTGTCGCTGGCAGCGAATGCCAATTTCAATTTCGTTTTGGTGTGGAGGAAATTATGTTATTTGTTGACACTCCACCGCCATCATAGGCGGCTGCTTTTCTAAAAATGATTAAATAAAACGGTGCAACAATGGCGAAAGTAGCGCACTATAACTCATGATATCTTCC...
978 bp · TkA05G057900|TK1151|CDS
ATGGCGCGTTCCGCATTAGACGAAATGTCGGATTCTGGCGCCTTCATTAGAAGTCCTTCAACTTTCCGTAGCTTCATCTCACGAGATCCAAACTCCACTTTTCCAACCGAATCCGGAAGATACCATTTATATGTATCTTACGCTTGCCCTTGGGCCTCTCGATGCCTTTCCTACTTGAAGATCAAAGGACTTGATAACGCCATTAGTTTCACGTCTGTTAAACCCATATGGGAGAGAACAAAGGAAAGTGATGAGCACAT...
Protein
Download Protein FASTA325 aa · TkA05G057900|TK1151|PROTEIN
MARSALDEMSDSGAFIRSPSTFRSFISRDPNSTFPTESGRYHLYVSYACPWASRCLSYLKIKGLDNAISFTSVKPIWERTKESDEHMGWVFPDTETEQSGASPDHINGAKNIRALYELASENYSGKYTVPVLWDKKLKTIVNNESEEIIRMFNTEFNEIAENPDLDLYPSHLQTQINELNGWIYSGINNGVYKCGFAKKQGPYEEAAKQLYEALDKCEEILAKQRYLCGNNLTEADIRLFVTLIRFDEVYAVHFKCNKKL...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA05G057900 |
|---|---|
| TK1151 ID | TkA05G057900 |
| OH-1004 ID | LXL04_019521 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 99.700 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 97.598Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA05G057900 |
|---|---|
| Location | Chr05:15401357-15404088 (+) |
| Description | Similar to yqjG: Glutathionyl-hydroquinone reductase YqjG (Escherichia coli (strain K12) |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006749 glutathione metabolic process Biological Process GO:0071555 cell wall organization Biological Process GO:0098869 cellular oxidant detoxification Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005794 Golgi apparatus Cellular Component GO:0005829 cytosol Cellular Component GO:0004364 glutathione transferase activity Molecular Function GO:0016491 oxidoreductase activity Molecular Function GO:0016672 oxidoreductase activity, acting on a sulfur group of donors, quinone or similar compound as acceptor Molecular Function GO:0042803 protein homodimerization activity Molecular Function GO:0045174 glutathione dehydrogenase (ascorbate) activity Molecular Function |
| KEGG gene cross-reference | ecj:JW3073 eco:b3102 ecoc:C3026_16935 sce:YKR076W sce:YMR251W spo:2539028 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF13417GST_N_343-68 aaPF13409GST_N_248-154 aaPF03469XH113-138 aaPF13417GST_N_3122-157 aaPF03469XH134-161 aaPF00043GST_C196-275 aaPF13410GST_C_2203-271 aaPF03469XH204-226 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA05G057900 | PF13417 | GST_N_3 | 43 | 68 | 0.00044 | 21.2 |
| TkA05G057900 | PF13409 | GST_N_2 | 48 | 154 | 3.7e-10 | 41.0 |
| TkA05G057900 | PF03469 | XH | 113 | 138 | 0.12 | 13.0 |
| TkA05G057900 | PF13417 | GST_N_3 | 122 | 157 | 0.00044 | 21.2 |
| TkA05G057900 | PF03469 | XH | 134 | 161 | 0.12 | 13.0 |
| TkA05G057900 | PF00043 | GST_C | 196 | 275 | 2.6e-08 | 34.7 |
| TkA05G057900 | PF13410 | GST_C_2 | 203 | 271 | 9.4e-15 | 55.2 |
| TkA05G057900 | PF03469 | XH | 204 | 226 | 0.12 | 13.0 |
| TkA05G057900 | PF14497 | GST_C_3 | 205 | 274 | 1.3e-06 | 29.2 |
| TkA05G057900 | PF21972 | Arc1p_N_like | 210 | 244 | 0.054 | 14.5 |
| TkA05G057900 | PF17171 | GST_C_6 | 212 | 272 | 9.3e-05 | 22.8 |
| TkA05G057900 | PF13409 | GST_N_2 | 298 | 307 | 3.7e-10 | 41.0 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.