RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA05G055910
Reference: TK1151 Chr: Chr05 Coordinates: 14858307-14859567 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1184 bp · TkA05G055910|TK1151|cDNA

TTTTTTCTTATATCTATCAAAACCATGTCATCCACAAAGACTTGCTTGCTTTTAATCCTTTTCTCCGCTACTTTGGTTTCACATACTATATCTCGGTTGCTCCCTGAAACTTCAAGCTATGAGAGCCACGAACAATGGATGGCTCGTTACGGACGTGTGTACAAGGATGCTCATGAGAAAGAACAACGCTCAAAGATTTTCCAAGAGAATGTTCAATACATAGAGTCATCCAACAATGTGATGAACAAAGGTTACAAACT...

CDS

Download CDS FASTA

1014 bp · TkA05G055910|TK1151|CDS

ATGTCATCCACAAAGACTTGCTTGCTTTTAATCCTTTTCTCCGCTACTTTGGTTTCACATACTATATCTCGGTTGCTCCCTGAAACTTCAAGCTATGAGAGCCACGAACAATGGATGGCTCGTTACGGACGTGTGTACAAGGATGCTCATGAGAAAGAACAACGCTCAAAGATTTTCCAAGAGAATGTTCAATACATAGAGTCATCCAACAATGTGATGAACAAAGGTTACAAACTAGCAGTCAATGCGTTTGCAGACCT...

Protein

Download Protein FASTA

337 aa · TkA05G055910|TK1151|PROTEIN

MSSTKTCLLLILFSATLVSHTISRLLPETSSYESHEQWMARYGRVYKDAHEKEQRSKIFQENVQYIESSNNVMNKGYKLAVNAFADLTNEEFTSTRNRFKAHECSSSTSAFKYANVTAVPSSMDWRKKGAVTPIKDQGQCGCCWAFSAVAAMEGITQLKTGKLVSLSEQELVDCDTSGQDQGCEGGLMDDAFDFILSNKGLTTESNYPYKGVDGTCNSNEESNHAATITGHEDVPANSETALLKAVASQPISVAIDASGS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA05G055910
TK1151 IDTkA05G055910
OH-1004 IDLXL04_019493
Relationship / confidenceNon Reciprocal Best Hit / Complex relationship
Protein identity (%)94.700
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA05G055910
LocationChr05:14858307-14859567 (+)
DescriptionSimilar to OsI_14861: Senescence-specific cysteine protease SAG39
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g45890 Cysteine protease that may have a developmental senescence specific cell death function during apoptosis, heavy metal detoxification, and hypersensitive response.
Identification of a promoter region responsible for the senescence-specific expression of SAG12.1999 · DOI: 10.1023/a:1006342412688
HDA6 is required for jasmonate response, senescence and flowering in Arabidopsis.2008 · DOI: 10.1093/jxb/erm300
Natural developmental variations in leaf and plant senescence in Arabidopsis thaliana.2008 · DOI: 10.1111/j.1438-8677.2008.00108.x
Epigenetic programming via histone methylation at WRKY53 controls leaf senescence in Arabidopsis thaliana.2009 · DOI: 10.1111/j.1365-313x.2008.03782.x
Nitric oxide is involved in cadmium-induced programmed cell death in Arabidopsis suspension cultures.2009 · DOI: 10.1104/pp.108.133397
At5g50260 Possesses protease activity in vitro.
KDEL-tailed cysteine endopeptidases involved in programmed cell death, intercalation of new cells, and dismantling of extensin scaffolds.2008 · DOI: 10.3732/ajb.2007404
Endoplasmic reticulum KDEL-tailed cysteine endopeptidase 1 of Arabidopsis (AtCEP1) is involved in pathogen defense.2014 · DOI: 10.3389/fpls.2014.00058
The cysteine protease CEP1, a key executor involved in tapetal programmed cell death, regulates pollen development in Arabidopsis.2014 · DOI: 10.1105/tpc.114.127282

Rice

Reference gene IDPossible functionPapers / DOI
UniProt: A2XQE8 Cysteine protease that may have a developmental senescence specific cell death function during apoptosis, heavy metal detoxification, and hypersensitive response. No verified direct reference in this release
Os04g0206300 Cysteine protease that may have a developmental senescence specific cell death function during apoptosis, heavy metal detoxification, and hypersensitive response. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_019493 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006508 proteolysis Biological Process
GO:0009555 pollen development Biological Process
GO:0009626 plant-type hypersensitive response Biological Process
GO:0009723 response to ethylene Biological Process
GO:0009733 response to auxin Biological Process
GO:0009735 response to cytokinin Biological Process
GO:0009737 response to abscisic acid Biological Process
GO:0009739 response to gibberellin Biological Process
GO:0009744 response to sucrose Biological Process
GO:0009749 response to glucose Biological Process
GO:0009750 response to fructose Biological Process
GO:0010150 leaf senescence Biological Process
KEGG gene cross-reference
ath:AT5G45890
ath:AT5G50260
osa:107276017
rcu:8278243
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.594
Rank 1 · TkA05G055910 · TK1151
Extracellular0.227
Rank 2 · TkA05G055910 · TK1151
Cytoplasm0.206
Rank 3 · TkA05G055910 · TK1151
Endoplasmic reticulum0.115
Rank 4 · TkA05G055910 · TK1151
Cell membrane0.098
Rank 5 · TkA05G055910 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07400IL1113-53 aa
PF08246Inhibitor_I2935-92 aa
PF26325YhjD57-104 aa
PF00112Peptidase_C166-66 aa
PF00112Peptidase_C1119-336 aa
PF18978DUF5714131-184 aa
PF03051Peptidase_C1_2132-153 aa
PF18978DUF5714270-283 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA05G055910PF07400IL1113530.1612.2
TkA05G055910PF08246Inhibitor_I2935925.6e-1865.7
TkA05G055910PF26325YhjD571040.1812.3
TkA05G055910PF00112Peptidase_C166661.6e-84284.1
TkA05G055910PF00112Peptidase_C11193361.6e-84284.1
TkA05G055910PF18978DUF57141311840.1212.6
TkA05G055910PF03051Peptidase_C1_21321533.6e-0523.5
TkA05G055910PF18978DUF57142702830.1212.6
TkA05G055910PF03051Peptidase_C1_22783183.6e-0523.5
TkA05G055910PF18978DUF57143233290.1212.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9FJ47Arabidopsis thalianasp|Q9FJ47|SAG12_ARATH Senescence-specific cysteine protease SAG1259.600%Swiss-ProtHigh
Q9FGR9Arabidopsis thalianasp|Q9FGR9|CEP1_ARATH KDEL-tailed cysteine endopeptidase CEP158.300%Swiss-ProtHigh
A2XQE8Oryza sativa subsp. indicasp|A2XQE8|SAG39_ORYSI Senescence-specific cysteine protease SAG3962.100%Swiss-ProtHigh
Q7XWK5Oryza sativa subsp. japonicasp|Q7XWK5|SAG39_ORYSJ Senescence-specific cysteine protease SAG3961.800%Swiss-ProtHigh

JBrowse

View in Genome Browser