TkA05G055450 | RubberDandelionOmics

Gene overview

TkA05G055450

Reference: TK1151 Chr: Chr05 Coordinates: 14718417-14721358 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1120 bp · TkA05G055450|TK1151|cDNA

CCAGTATCCACAACATCAAAAAACGCCCTAGAAACCAATCCATAAGAAACAAATCCAAACCACTCATAAATCACTCCACCTCACACAACAAAAGTATTAGATGATGAGAAGAACAAACCCATTGTCATCAACCCTCTGCAAATGGAGACCATTTTAGCTCCTCGCTCTTTATCTTCACTTTTCAATTTGAAATCCGCTCTCCAACAACAACAAAATCCCAAATCAAGCTCAAACGCTCTCACTCTCGCAAACGTTAAACC...

CDS

Download CDS FASTA

885 bp · TkA05G055450|TK1151|CDS

ATGGAGACCATTTTAGCTCCTCGCTCTTTATCTTCACTTTTCAATTTGAAATCCGCTCTCCAACAACAACAAAATCCCAAATCAAGCTCAAACGCTCTCACTCTCGCAAACGTTAAACCCATTTGTTGTAATCTAAAGAAGGATTCAGTTTCCCAATCTCTTTCAGCAATACCCACCAGCCCCAATTGGGTTTCCCATGTCCAACATGGATTAGCTGCTTTAGCGATCTCGTTAGCACTAAACTTTACCCCTATTTTGGC...

Protein

Download Protein FASTA

294 aa · TkA05G055450|TK1151|PROTEIN

METILAPRSLSSLFNLKSALQQQQNPKSSSNALTLANVKPICCNLKKDSVSQSLSAIPTSPNWVSHVQHGLAALAISLALNFTPILASGSAFASEFNVLNDGPPKDSYVVDDAGVLSRVTRSDLKNLLSDLEYRKKIRINFVTVRKLTSKADAFEYADQVLERWYPTLEDGNNKGIVVLVTSQKEGAVTGGPEFIKAVGDTVLDATVSQNLPVLATDEKYNEAVYSTAKRLVAAIDGLPDPGGPETKENKRESNFKTKEE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G055450`
TK1151 ID	TkA05G055450
OH-1004 ID	LXL04_019478
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G055450

Location Chr05:14718417-14721358 (+)

Description Similar to At1g54780: UPF0603 protein At1g54780, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g54780`	UPF0603 protein At1g54780, chloroplastic.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2Y4G9`	UPF0603 protein OsI_019212, chloroplastic.	No verified direct reference in this release
`Os05g0401100`	UPF0603 protein Os05g0401100, chloroplastic.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019478 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010206 photosystem II repair Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009534 chloroplast thylakoid Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009543 chloroplast thylakoid lumen Cellular Component

GO:0009579 thylakoid Cellular Component

GO:0031977 thylakoid lumen Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0003993 acid phosphatase activity Molecular Function

KEGG gene cross-reference

ath:AT1G54780

dosa:Os05g0401100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.986

Rank 1 · TkA05G055450 · TK1151

Mitochondrion0.018

Rank 2 · TkA05G055450 · TK1151

Nucleus0.011

Rank 3 · TkA05G055450 · TK1151

Cytoplasm0.010

Rank 4 · TkA05G055450 · TK1151

Cell membrane0.009

Rank 5 · TkA05G055450 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04536TPM_phosphatase109-233 aa

PF13103TonB_2155-209 aa

PF13103TonB_2218-242 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G055450	`PF04536`	TPM_phosphatase	109	233	8.2e-21	74.9
TkA05G055450	`PF13103`	TonB_2	155	209	0.049	14.5
TkA05G055450	`PF13103`	TonB_2	218	242	0.049	14.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZVL6`	Arabidopsis thaliana	sp\|Q9ZVL6\|U603_ARATH UPF0603 protein At1g54780, chloroplastic	69.700%	Swiss-Prot	High
`A2Y4G9`	Oryza sativa subsp. indica	sp\|A2Y4G9\|U603_ORYSI UPF0603 protein OsI_019212, chloroplastic	75.100%	Swiss-Prot	High
`Q6ATY4`	Oryza sativa subsp. japonica	sp\|Q6ATY4\|U603_ORYSJ UPF0603 protein Os05g0401100, chloroplastic	75.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card