TkA05G052280 | RubberDandelionOmics

Gene overview

TkA05G052280

Reference: TK1151 Chr: Chr05 Coordinates: 13940698-13942435 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1505 bp · TkA05G052280|TK1151|cDNA

GCAACAAGAAGGTTTAAGAAAAGAAAATAAATAAATAAATATTACACCCCAATTGCGACCACTGAAACCAAATGGTCAACGTAGAACACCTACCACACGTCTACACCACTTTACAAAATGGCCTCCTAAATTCAGATCATCATTCAACCAACCCTATCATTCATCTCATGGCTAAGTTAACCGAAATCACCACTAAACCAACGCCGACAAAAACGCCACCACCTCATGGGGTTCCGGTCTTCTCTTCTTCACGGTGGCTG...

CDS

Download CDS FASTA

384 bp · TkA05G052280|TK1151|CDS

ATGATTTATTTCACCGATGCTACATATAAATATATTTATCGGGAAGCTTTGAACGATCTTTTAGAGGGTCGACCTCATGGTAAATTATTGAGCTATGATCCATCAACAAAAGAAACAAAAGTGCTTGCTCGGGACCTTTACTTTGCTAATGGTGTTGAACTTTCACCCGATCAAGACTTTCTTATCTTTTCCGAGACTTTCATGAGAAGGTGCTCTCGGTACTATTTACAAGGGAAAAGAAGGGAACTATCGATATTTTC...

Protein

Download Protein FASTA

127 aa · TkA05G052280|TK1151|PROTEIN

MIYFTDATYKYIYREALNDLLEGRPHGKLLSYDPSTKETKVLARDLYFANGVELSPDQDFLIFSETFMRRCSRYYLQGKRRELSIFSQRTYLVYQIMYDMMAKGITGSQCHGTIPFCLKTHINTVFA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G052280`
TK1151 ID	TkA05G052280
OH-1004 ID	LXL04_019445
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	89.900
Protein coverage (%)	TK1151 69.291 / OH-1004 21.394 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G052280

Location Chr05:13940698-13942435 (+)

Description Similar to SSL5: Protein STRICTOSIDINE SYNTHASE-LIKE 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g51440`	Protein STRICTOSIDINE SYNTHASE-LIKE 6.	No verified direct reference in this release
`At3g51430`	Protein STRICTOSIDINE SYNTHASE-LIKE 5.	No verified direct reference in this release
`At3g51450`	Protein STRICTOSIDINE SYNTHASE-LIKE 7.	No verified direct reference in this release
`At3g51420`	Protein STRICTOSIDINE SYNTHASE-LIKE 4.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019445 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009611 response to wounding Biological Process

GO:0009615 response to virus Biological Process

GO:0009620 response to fungus Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009751 response to salicylic acid Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0005773 vacuole Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009986 cell surface Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT3G51420

ath:AT3G51430

ath:AT3G51440

ath:AT3G51450

gga:416715

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.400

Rank 1 · TkA05G052280 · TK1151

Cytoplasm0.211

Rank 2 · TkA05G052280 · TK1151

Endoplasmic reticulum0.138

Rank 3 · TkA05G052280 · TK1151

Lysosome / Vacuole0.105

Rank 4 · TkA05G052280 · TK1151

Nucleus0.099

Rank 5 · TkA05G052280 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03088Str_synth2-78 aa

PF08450SGL25-83 aa

PF01731Arylesterase35-74 aa

PF03088Str_synth89-107 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G052280	`PF03088`	Str_synth	2	78	3.2e-31	108.0
TkA05G052280	`PF08450`	SGL	25	83	9.3e-06	26.1
TkA05G052280	`PF01731`	Arylesterase	35	74	0.013	14.9
TkA05G052280	`PF03088`	Str_synth	89	107	3.2e-31	108.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SD05`	Arabidopsis thaliana	sp\|Q9SD05\|SSL6_ARATH Protein STRICTOSIDINE SYNTHASE-LIKE 6	61.200%	Swiss-Prot	Medium
`Q9CAZ7`	Arabidopsis thaliana	sp\|Q9CAZ7\|SSL5_ARATH Protein STRICTOSIDINE SYNTHASE-LIKE 5	58.800%	Swiss-Prot	Medium
`Q9SD04`	Arabidopsis thaliana	sp\|Q9SD04\|SSL7_ARATH Protein STRICTOSIDINE SYNTHASE-LIKE 7	56.800%	Swiss-Prot	Medium
`Q9SD07`	Arabidopsis thaliana	sp\|Q9SD07\|SSL4_ARATH Protein STRICTOSIDINE SYNTHASE-LIKE 4	52.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card