TkA05G051460 | RubberDandelionOmics

Gene overview

TkA05G051460

Reference: TK1151 Chr: Chr05 Coordinates: 13699705-13705161 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1700 bp · TkA05G051460|TK1151|cDNA

CACAGTATCCCTGTGACCAATCTCCCATTTCTCTCATTCTTCATGTGTTGTGTGTACTCTTTTATTTACTTCAACTCTTCCCCAAATTCTCCCTCCCTCTCTTCAATAAATTCCATATTCCTTAAAGGAATCTTGCAGTTACAACTTAAAACCCAGTTCTGACTTGCAGAAATGCCTTCTTCTACTTCTATCAATATCCTTTTGGGTTTTTTCATATGTGTTTCTCTTGCCCACACTACAATCTTCTCTTCCGCGAAGGT...

CDS

Download CDS FASTA

2313 bp · TkA05G051460|TK1151|CDS

ATGCCTTCTTCTACTTCTATCAATATCCTTTTGGGTTTTTTCATATGTGTTTCTCTTGCCCACACTACAATCTTCTCTTCCGCGAAGGTGTATGTGGTGTATATGGGCGGCAATGATATCGATGACCCAGATGAAATTTCGATGAAAAATCATCAAATGCTTGTTTCTGTTCATAGTGGAAGTGTTGAAGAAGCACACGCGTCTCATCTGTATAGCTATAAACATGGATTTAGAGGTTTTGCAGCCAAATTAACAGAGGA...

Protein

Download Protein FASTA

770 aa · TkA05G051460|TK1151|PROTEIN

MPSSTSINILLGFFICVSLAHTTIFSSAKVYVVYMGGNDIDDPDEISMKNHQMLVSVHSGSVEEAHASHLYSYKHGFRGFAAKLTEDQALQIAKMPEVVSVFENKRRSLHTTHSWDFIGLVGEETMEIPGFSTKDQVNVIIGFIDTGIWPESESFSDADMPPVPAGWKGKCQSGEEFNVTHCNRKLIGARYYLSGYEAENQNSEYDDDPKNIKSFRSPRDSNGHGTHTASTAAGRYVTDMNYKGLARGGARGGAPMARVA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G051460`
TK1151 ID	TkA05G051460
OH-1004 ID	LXL04_019431
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G051460

Location Chr05:13699705-13705161 (+)

Description Similar to SbtS: Subtilisin-like serine-protease S

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g59810`	Serine protease.	Overexpression of an Arabidopsis gene encoding a subtilase (AtSBT5.4) produces a clavata-like phenotype.2009 · DOI: 10.1007/s00425-009-0976-5
`At4g34980`	Subtilisin-like protease SBT1.6.	No verified direct reference in this release
`At3g14240`	Subtilisin-like protease SBT1.5.	No verified direct reference in this release
`At1g32940`	Serine protease that cleaves the pectin methylesterase 17 (PME17) protein to release the PME17 mature form in the apoplasm.	Arabidopsis PECTIN METHYLESTERASE17 is co-expressed with and processed by SBT3.5, a subtilisin-like serine protease.2014 · DOI: 10.1093/aob/mcu035
`At4g10550`	Subtilisin-like protease SBT3.6.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019431 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0009609 response to symbiotic bacterium Biological Process

GO:0009610 response to symbiotic fungus Biological Process

GO:0009733 response to auxin Biological Process

GO:0009827 plant-type cell wall modification Biological Process

GO:0010074 maintenance of meristem identity Biological Process

GO:0010102 lateral root morphogenesis Biological Process

GO:0036377 arbuscular mycorrhizal association Biological Process

GO:0048731 system development Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005615 extracellular space Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

KEGG gene cross-reference

ath:AT2G04160

ath:AT3G14240

ath:AT4G34980

ath:AT5G59810

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.581

Rank 1 · TkA05G051460 · TK1151

Lysosome / Vacuole0.141

Rank 2 · TkA05G051460 · TK1151

Cell membrane0.096

Rank 3 · TkA05G051460 · TK1151

Cytoplasm0.069

Rank 4 · TkA05G051460 · TK1151

Endoplasmic reticulum0.060

Rank 5 · TkA05G051460 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05922Inhibitor_I930-110 aa

PF21864MORF_dom52-105 aa

PF00082Peptidase_S8138-606 aa

PF02225PA401-471 aa

PF21864MORF_dom621-637 aa

PF17766fn3_6663-759 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G051460	`PF05922`	Inhibitor_I9	30	110	2.9e-19	70.2
TkA05G051460	`PF21864`	MORF_dom	52	105	0.01	16.4
TkA05G051460	`PF00082`	Peptidase_S8	138	606	1.3e-45	156.6
TkA05G051460	`PF02225`	PA	401	471	1.2e-06	29.3
TkA05G051460	`PF21864`	MORF_dom	621	637	0.01	16.4
TkA05G051460	`PF17766`	fn3_6	663	759	5.4e-23	81.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JXC5`	Arabidopsis thaliana	sp\|F4JXC5\|SBT54_ARATH Subtilisin-like protease SBT5.4	43.000%	Swiss-Prot	Medium
`O49607`	Arabidopsis thaliana	sp\|O49607\|SBT16_ARATH Subtilisin-like protease SBT1.6	42.800%	Swiss-Prot	Medium
`Q9LUM3`	Arabidopsis thaliana	sp\|Q9LUM3\|SBT15_ARATH Subtilisin-like protease SBT1.5	44.400%	Swiss-Prot	Medium
`Q9MAP7`	Arabidopsis thaliana	sp\|Q9MAP7\|SBT35_ARATH Subtilisin-like protease SBT3.5	42.100%	Swiss-Prot	Medium
`Q8L7I2`	Arabidopsis thaliana	sp\|Q8L7I2\|SBT36_ARATH Subtilisin-like protease SBT3.6	44.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card