TkA05G043780 | RubberDandelionOmics

Gene overview

TkA05G043780

Reference: TK1151 Chr: Chr05 Coordinates: 11617716-11622217 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1624 bp · TkA05G043780|TK1151|cDNA

GGGGACAGATCAACATTCAAAGCGGAACCCCAACGTAATCGCCCGCCCGGTGACACCCTCCGAAATCGGAGAAGCAAAACCCTACGTGAAACCATGTATGGGGGAGACGAAGTATCGGCGATAGTTGTAGACTTGGGTTCGCATACATGTAAAGCTGGTTACGCTGGTGAAGATGCTCCCAAGGCTGTGTTTCCTTCTGTCATTGGAGCAATTGATCAAATGGAAGTTGATGAGACTGATAACCCAGAGAAGAATAGTGA...

CDS

Download CDS FASTA

1389 bp · TkA05G043780|TK1151|CDS

GGGGACAGATCAACATTCAAAGCGGAACCCCAACGTAATCGCCCGCCCGGTGACACCCTCCGAAATCGGAGAAGCAAAACCCTACGTGAAACCATGTATGGGGGAGACGAAGTATCGGCGATAGTTGTAGACTTGGGTTCGCATACATGTAAAGCTGGTTACGCTGGTGAAGATGCTCCCAAGGCTGTGTTTCCTTCTGTCATTGGAGCAATTGATCAAATGGAAGTTGATGAGACTGATAACCCAGAGAAGAATAGTGA...

Protein

Download Protein FASTA

462 aa · TkA05G043780|TK1151|PROTEIN

GDRSTFKAEPQRNRPPGDTLRNRRSKTLRETMYGGDEVSAIVVDLGSHTCKAGYAGEDAPKAVFPSVIGAIDQMEVDETDNPEKNSEPKSKGKRKLYVGSSAMGYRRDHMEVLPSIKDGIVTDWDIVESIWDHAFKECLLVDPKEHPMLLAEPSSNTQQQREKAAELMFEKYQAPALFLAKNAVLTSFASGRATSLVVDSGGGSTIVAPVHDGYVLQKAVSSSPIGGELLTDCLMKSLESKGVKIRPRYSFKRKEVRPGE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G043780`
TK1151 ID	TkA05G043780
OH-1004 ID	LXL04_019336
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 93.145 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G043780

Location Chr05:11617716-11622217 (-)

Description Similar to ARP4: Actin-related protein 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g18450`	Involved in several developmental processes including organization of plant organs, flowering time, anther development, flower senescence and fertility, probably by regulating the chromatin structure.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2YR10`	Involved in several developmental processes including organization of plant organs, flowering time, anther development, flower senescence and fertility, probably by regulating the chromatin structure.	No verified direct reference in this release
`Os08g0137200`	Involved in several developmental processes including organization of plant organs, flowering time, anther development, flower senescence and fertility, probably by regulating the chromatin structure.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019336 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000723 telomere maintenance Biological Process

GO:0006275 regulation of DNA replication Biological Process

GO:0006281 DNA repair Biological Process

GO:0006282 regulation of DNA repair Biological Process

GO:0006310 DNA recombination Biological Process

GO:0006325 chromatin organization Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0008284 positive regulation of cell population proliferation Biological Process

GO:0030071 regulation of mitotic metaphase/anaphase transition Biological Process

KEGG gene cross-reference

ath:AT1G18450

dosa:Os08g0137200

mmu:56456

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.696

Rank 1 · TkA05G043780 · TK1151

Cytoplasm0.418

Rank 2 · TkA05G043780 · TK1151

Cell membrane0.051

Rank 3 · TkA05G043780 · TK1151

Mitochondrion0.038

Rank 4 · TkA05G043780 · TK1151

Lysosome / Vacuole0.037

Rank 5 · TkA05G043780 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00022Actin35-462 aa

PF06723MreB_Mbl103-236 aa

PF02541Ppx-GppA183-234 aa

PF06723MreB_Mbl361-400 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G043780	`PF00022`	Actin	35	462	7.3e-160	532.8
TkA05G043780	`PF06723`	MreB_Mbl	103	236	1.8e-06	27.7
TkA05G043780	`PF02541`	Ppx-GppA	183	234	0.13	12.4
TkA05G043780	`PF06723`	MreB_Mbl	361	400	1.8e-06	27.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84M92`	Arabidopsis thaliana	sp\|Q84M92\|ARP4_ARATH Actin-related protein 4	76.900%	Swiss-Prot	High
`A2YR10`	Oryza sativa subsp. indica	sp\|A2YR10\|ARP4_ORYSI Actin-related protein 4	71.900%	Swiss-Prot	High
`Q6ZJW9`	Oryza sativa subsp. japonica	sp\|Q6ZJW9\|ARP4_ORYSJ Actin-related protein 4	71.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card