TkA05G038970 | RubberDandelionOmics

Gene overview

TkA05G038970

Reference: TK1151 Chr: Chr05 Coordinates: 10549547-10551065 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

924 bp · TkA05G038970|TK1151|cDNA

ATGGAAGATCAAGCTCAAACTCAAGTTCCAAGTCCGACTCCCAGTAGTCCAAGAAGCCATTGTCTTGAAAGAAATGAACCCGTTAGGTCACGATGGACCCCTAAACCTGAACAAATCCTTATTCTCGAGTCAATTTTCAACAGCGGCATGGTTAATCCTCCCAAGGAGGAAACCGTGAAGATAAGGAAGCTCCTTGAGAAATTCGGGTCTGTTGGCGACGCTAATGTCTTCTACTGGTTTCAGAACCGCCGTTCCAGATC...

CDS

Download CDS FASTA

924 bp · TkA05G038970|TK1151|CDS

ATGGAAGATCAAGCTCAAACTCAAGTTCCAAGTCCGACTCCCAGTAGTCCAAGAAGCCATTGTCTTGAAAGAAATGAACCCGTTAGGTCACGATGGACCCCTAAACCTGAACAAATCCTTATTCTCGAGTCAATTTTCAACAGCGGCATGGTTAATCCTCCCAAGGAGGAAACCGTGAAGATAAGGAAGCTCCTTGAGAAATTCGGGTCTGTTGGCGACGCTAATGTCTTCTACTGGTTTCAGAACCGCCGTTCCAGATC...

Protein

Download Protein FASTA

307 aa · TkA05G038970|TK1151|PROTEIN

MEDQAQTQVPSPTPSSPRSHCLERNEPVRSRWTPKPEQILILESIFNSGMVNPPKEETVKIRKLLEKFGSVGDANVFYWFQNRRSRSRRRQRQIQASLMTTAGSVEQHQVQQQLPMLTRYMSGGGGGDGGGGAIEYQGGSTGNYTAPPSAVGFHIQQPSFFPLAGSSSSSSSSSSSSSSSSRLGGPDEVYTLSGQSSGGFPEQNASIPSSFQHLDTSKSHYQFGLGVITVFINGVPTEVESGPLNMKSMLGEDLMIVHSS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G038970`
TK1151 ID	TkA05G038970
OH-1004 ID	LXL04_019300
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G038970

Location Chr05:10549547-10551065 (-)

Description Similar to WOX11: WUSCHEL-related homeobox 11

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g17810`	Transcription factor which may be involved in developmental processes.	No verified direct reference in this release
`At3g03660`	Transcription factor which may be involved in developmental processes.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: B8B644`	Transcription factor which may be involved in developmental processes.	No verified direct reference in this release
`Os07g0684900`	Transcription factor involved in crown root development.	The WUSCHEL-related homeobox gene WOX11 is required to activate shoot-borne crown root development in rice.2009 · DOI: 10.1105/tpc.108.061655 The Interaction between Rice ERF3 and WOX11 Promotes Crown Root Development by Regulating Gene Expression Involved in Cytokinin Signaling.2015 · DOI: 10.1105/tpc.15.00227 Rice Homeodomain Protein WOX11 Recruits a Histone Acetyltransferase Complex to Establish Programs of Cell Proliferation of Crown Root Meristem.2017 · DOI: 10.1105/tpc.16.00908 Transcriptional regulatory network of WOX11 is involved in the control of crown root development, cytokinin signals, and redox in rice.2017 · DOI: 10.1093/jxb/erx153 The YUCCA-Auxin-WOX11 Module Controls Crown Root Development in Rice.2018 · DOI: 10.3389/fpls.2018.00523
`Os03g0325600`	Transcription factor which may be involved in developmental processes.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019300 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0010311 lateral root formation Biological Process

GO:0048364 root development Biological Process

GO:0048830 adventitious root development Biological Process

GO:1905393 plant organ formation Biological Process

GO:0005634 nucleus Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

KEGG gene cross-reference

ath:AT3G03660

ath:AT5G17810

dosa:Os07g0684900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.971

Rank 1 · TkA05G038970 · TK1151

Cytoplasm0.110

Rank 2 · TkA05G038970 · TK1151

Cell membrane0.026

Rank 3 · TkA05G038970 · TK1151

Endoplasmic reticulum0.019

Rank 4 · TkA05G038970 · TK1151

Plastid0.011

Rank 5 · TkA05G038970 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00424REV12-57 aa

PF00046Homeodomain29-89 aa

PF00424REV81-119 aa

PF25184YxzE122-132 aa

PF27961CSNKA2IP164-183 aa

PF25184YxzE167-199 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G038970	`PF00424`	REV	12	57	0.96	10.2
TkA05G038970	`PF00046`	Homeodomain	29	89	9e-11	42.2
TkA05G038970	`PF00424`	REV	81	119	0.96	10.2
TkA05G038970	`PF25184`	YxzE	122	132	0.33	12.7
TkA05G038970	`PF27961`	CSNKA2IP	164	183	4.3	7.5
TkA05G038970	`PF25184`	YxzE	167	199	0.33	12.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GY25`	Arabidopsis thaliana	sp\|Q8GY25\|WOX12_ARATH WUSCHEL-related homeobox 12	45.500%	Swiss-Prot	Medium
`Q6X7J3`	Arabidopsis thaliana	sp\|Q6X7J3\|WOX11_ARATH WUSCHEL-related homeobox 11	45.400%	Swiss-Prot	Medium
`B8B644`	Oryza sativa subsp. indica	sp\|B8B644\|WOX11_ORYSI WUSCHEL-related homeobox 11	40.300%	Swiss-Prot	Medium
`Q0D3I7`	Oryza sativa subsp. japonica	sp\|Q0D3I7\|WOX11_ORYSJ WUSCHEL-related homeobox 11	40.300%	Swiss-Prot	Medium
`Q10M29`	Oryza sativa subsp. japonica	sp\|Q10M29\|WOX6_ORYSJ WUSCHEL-related homeobox 6	40.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card