RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA05G038210
Reference: TK1151 Chr: Chr05 Coordinates: 10323693-10327416 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2324 bp · TkA05G038210|TK1151|cDNA

TTCATTTTTTAATTTTGTTTGTTTGTCTTAAAAAACGATTCAGAACAGAGTGTTTGCTTCCACTGTAGTCTCAAGTCGTCGGGAATCTAATTCCCCCGTCGTTCACGGTTCCCGGACCACCGTCCGGTACTAGTGCCTCTTCAATAGCTTGAATCAATCCATATCCAAATGATGATTTGATTTCTAGCTTTCTCTATTTCAATCAAATGAACGGATCGGAAAATCAACAAGATCGTATCTACTCATCGAAGGAAGAGTCG...

CDS

Download CDS FASTA

1710 bp · TkA05G038210|TK1151|CDS

ATGAACGGATCGGAAAATCAACAAGATCGTATCTACTCATCGAAGGAAGAGTCGGAAGAAGAAATTCTCTTTCATCTCGATGATTCATCTTTGACCTCCAAATCTTTCTCCAATTACAAAAGTGTGATGACCACTCTTTCTGATGACTCTCACCACCCCCTCGCCACCCCAGCCGACACCGATCCTTTACTCTCACCACCAGCTCCAGCTCCAACTCCATCTCCACCGCCACCGCCCCAAAACCCTAACTCCAACAATGA...

Protein

Download Protein FASTA

569 aa · TkA05G038210|TK1151|PROTEIN

MNGSENQQDRIYSSKEESEEEILFHLDDSSLTSKSFSNYKSVMTTLSDDSHHPLATPADTDPLLSPPAPAPTPSPPPPPQNPNSNNDSKNDPLTYADVNFMHPNTDGEEVRYAENPRDSSERLAPLSTPAPLPYLKITVSNPQKEMESSNSIVPGGNTYVTYLITTKTNMAEFGGPQFTVRRRFKDVVTLSDRLMEGYRGFFIPPRPDKSVVESQVMQKHEFVEQRRNALEKYLQKLAEHPVIRQSDELRVFLQVQGKLP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA05G038210
TK1151 IDTkA05G038210
OH-1004 IDLXL04_019286
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)99.300
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA05G038210
LocationChr05:10323693-10327416 (+)
DescriptionSimilar to SNX2B: Sorting nexin 2B
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g07120 Plays a role in vesicular protein sorting.
Overexpression of Arabidopsis sorting nexin AtSNX2b inhibits endocytic trafficking to the vacuole.2008 · DOI: 10.1093/mp/ssn057
At5g58440 Plays a role in vesicular protein sorting (By similarity). No verified direct reference in this release
At5g06140 Plays a role in vesicular protein sorting.
AtSNX1 defines an endosome for auxin-carrier trafficking in Arabidopsis.2006 · DOI: 10.1038/nature05046
Evidence for a sorting endosome in Arabidopsis root cells.2008 · DOI: 10.1111/j.1365-313x.2007.03338.x
Differential degradation of PIN2 auxin efflux carrier by retromer-dependent vacuolar targeting.2008 · DOI: 10.1073/pnas.0808073105
BLOS1, a putative BLOC-1 subunit, interacts with SNX1 and modulates root growth in Arabidopsis.2010 · DOI: 10.1242/jcs.069732
Analyses of sorting nexins reveal distinct retromer-subcomplex functions in development and protein sorting in Arabidopsis thaliana.2010 · DOI: 10.1105/tpc.110.078451

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_019286 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006623 protein targeting to vacuole Biological Process
GO:0006886 intracellular protein transport Biological Process
GO:0006896 Golgi to vacuole transport Biological Process
GO:0008333 endosome to lysosome transport Biological Process
GO:0009958 positive gravitropism Biological Process
GO:0015031 protein transport Biological Process
GO:0016192 vesicle-mediated transport Biological Process
GO:0032502 developmental process Biological Process
GO:0034498 early endosome to Golgi transport Biological Process
GO:0042147 retrograde transport, endosome to Golgi Biological Process
GO:0045324 late endosome to vacuole transport Biological Process
GO:0048364 root development Biological Process
KEGG gene cross-reference
ath:AT5G06140
ath:AT5G07120
ath:AT5G58440
hsa:6643
mmu:67804
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.389
Rank 1 · TkA05G038210 · TK1151
Cell membrane0.280
Rank 2 · TkA05G038210 · TK1151
Golgi apparatus0.244
Rank 3 · TkA05G038210 · TK1151
Nucleus0.139
Rank 4 · TkA05G038210 · TK1151
Endoplasmic reticulum0.129
Rank 5 · TkA05G038210 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01086Clathrin_lg_ch33-55 aa
PF00787PX173-255 aa
PF06456Arfaptin218-237 aa
PF11471Sugarporin_N223-235 aa
PF09325Vps5226-237 aa
PF09325Vps5324-559 aa
PF01086Clathrin_lg_ch328-430 aa
PF06456Arfaptin334-549 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA05G038210PF01086Clathrin_lg_ch33550.9310.1
TkA05G038210PF00787PX1732555.6e-1969.2
TkA05G038210PF06456Arfaptin2182370.009916.2
TkA05G038210PF11471Sugarporin_N2232353.28.8
TkA05G038210PF09325Vps52262374.4e-1969.7
TkA05G038210PF09325Vps53245594.4e-1969.7
TkA05G038210PF01086Clathrin_lg_ch3284300.9310.1
TkA05G038210PF06456Arfaptin3345490.009916.2
TkA05G038210PF00787PX3363565.6e-1969.2
TkA05G038210PF00957Synaptobrevin3373736.47.5
TkA05G038210PF11471Sugarporin_N3433593.28.8
TkA05G038210PF00957Synaptobrevin4614816.47.5
TkA05G038210PF01086Clathrin_lg_ch5085270.9310.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
B9DFS6Arabidopsis thalianasp|B9DFS6|SNX2B_ARATH Sorting nexin 2B58.400%Swiss-ProtHigh
Q8L5Z7Arabidopsis thalianasp|Q8L5Z7|SNX2A_ARATH Sorting nexin 2A59.400%Swiss-ProtHigh
Q9FG38Arabidopsis thalianasp|Q9FG38|SNX1_ARATH Sorting nexin 125.300%Swiss-ProtLow

JBrowse

View in Genome Browser