Gene Card
Gene overview
cDNA / CDS / Protein Sequences
396 bp · TkA05G007750|TK1151|cDNA
ATGACCCTTTTGGCCGGAATTAGTCACCGGTGTATATGTAATCGCCTGCTTTGCCTTGTTATACGTCATCTCCACCATCGGCAACACCAGTCCATACAACGCCGTGATCGAATACGGCGTGAATTTCTGTTTCACCAACAGAAACGCGACGCCGGTGAGGACGCCGATCACTGCCGTCATCGAATACAACGCAGGGAGGCGGAAGATTCCGCAGGCGTAGAGAAAGTCGTCGACGCCGGTGTGGACGCCGATCACCGCCG...
396 bp · TkA05G007750|TK1151|CDS
ATGACCCTTTTGGCCGGAATTAGTCACCGGTGTATATGTAATCGCCTGCTTTGCCTTGTTATACGTCATCTCCACCATCGGCAACACCAGTCCATACAACGCCGTGATCGAATACGGCGTGAATTTCTGTTTCACCAACAGAAACGCGACGCCGGTGAGGACGCCGATCACTGCCGTCATCGAATACAACGCAGGGAGGCGGAAGATTCCGCAGGCGTAGAGAAAGTCGTCGACGCCGGTGTGGACGCCGATCACCGCCG...
Protein
Download Protein FASTA131 aa · TkA05G007750|TK1151|PROTEIN
MTLLAGISHRCICNRLLCLVIRHLHHRQHQSIQRRDRIRREFLFHQQKRDAGEDADHCRHRIQRREAEDSAGVEKVVDAGVDADHRRCEKTFLDASTRQWFRPKGSYANNFKKFTGKWGAKKSLGTERVKK
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA05G007750 |
|---|---|
| TK1151 ID | TkA05G007750 |
| OH-1004 ID | LXL04_026411 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 82.200 |
| Protein coverage (%) | TK1151 68.702 / OH-1004 17.476Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA05G007750 |
|---|---|
| Location | Chr05:2262461-2262856 (+) |
| Description | Similar to CSN5B: COP9 signalosome complex subunit 5b |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0000338 protein deneddylation Biological Process GO:0006412 translation Biological Process GO:0006508 proteolysis Biological Process GO:0009585 red, far-red light phototransduction Biological Process GO:0009640 photomorphogenesis Biological Process GO:0009733 response to auxin Biological Process GO:0010093 specification of floral organ identity Biological Process GO:0010100 negative regulation of photomorphogenesis Biological Process GO:0010387 COP9 signalosome assembly Biological Process GO:0010971 positive regulation of G2/M transition of mitotic cell cycle Biological Process GO:0019954 asexual reproduction Biological Process GO:0031347 regulation of defense response Biological Process |
| KEGG gene cross-reference | ath:AT1G22920 ath:AT1G71230 ddi:DDB_G0284597 dosa:Os04g0654700 hsa:10987 osa:4337249 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
No result was found for this query.
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.