RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA05G005250
Reference: TK1151 Chr: Chr05 Coordinates: 1550385-1556607 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2096 bp · TkA05G005250|TK1151|cDNA

ATTTCATCACTTTTTCATATAGTTGTCATTTGTCAACTAGTAATAGTAGTCACAAGCATCAATCTTGAGTTTTTGACCCTCGTCCTCACGCTGCAATAAACCCCTCTTTTAATTCGTCGCCGTGATTGCTGCAAGAGAAAGGAAAACAAGGAAATAAAGCAAAACCAGTCCACGCCAAGCTAAAAACATTGGAGTCTGATTAGTGATTAATCGTTAGGTTTTTACTCCCACTGCCAGTTCCAGCACCATGGATCAACACA...

CDS

Download CDS FASTA

1032 bp · TkA05G005250|TK1151|CDS

ATGGATCAACACAGAGACTACCGTTCTTCTTTGTCCTACGACAACTCTATCCCTCCTCCCAACTACCACGACGGTAGCAACTTTAACCATGGTGGTGACGGCCACTACGATCATCACCGTAGATACCAAAACCACCATCAAGATTTTGGTAACGAACCAACCGATTCATTTGGACACGCCAATGGAACTGCATTTGCTGGACGAAAGCGACAATTCTCTCACTCTGCTCTTGGAGCTCCTGGATACAACAATGATAGCAA...

Protein

Download Protein FASTA

343 aa · TkA05G005250|TK1151|PROTEIN

MDQHRDYRSSLSYDNSIPPPNYHDGSNFNHGGDGHYDHHRRYQNHHQDFGNEPTDSFGHANGTAFAGRKRQFSHSALGAPGYNNDSNYAKLYVKGVPREASEQDIQSLFGKHGNIIEVVLFKQLKNVQEQDCCFVKYAKTEDAAQAIRSLHNQHIFPGGIRPIEVKYASTSKKQERIGLGGFRGNECKLFVASLNKHASEGEIAQIFSPYGCVEEVFLLRDEQKQNRGTGFITFTQKDMAVAAINALSGTFIMKGCEQPL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA05G005250
TK1151 IDTkA05G005250
OH-1004 IDLXL04_018953
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)99.700
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA05G005250
LocationChr05:1550385-1556607 (-)
DescriptionSimilar to FCA: Flowering time control protein FCA
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g16280 Plays a major role in the promotion of the transition of the vegetative meristem to reproductive development. No verified direct reference in this release
At1g03457 RNA-binding protein involved in the regulation of flowering time. No verified direct reference in this release
At4g03110 RNA-binding protein involved in the regulation of flowering time.
A putative RNA-binding protein positively regulates salicylic acid-mediated immunity in Arabidopsis.2010 · DOI: 10.1094/mpmi-05-10-0106

Rice

Reference gene IDPossible functionPapers / DOI
UniProt: B8BCZ8 Plays a major role in the promotion of the transition of the vegetative meristem to reproductive development (By similarity). No verified direct reference in this release
Os09g0123200 Plays a major role in the promotion of the transition of the vegetative meristem to reproductive development. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_018953 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0000398 mRNA splicing, via spliceosome Biological Process
GO:0008361 regulation of cell size Biological Process
GO:0009553 embryo sac development Biological Process
GO:0009793 embryo development ending in seed dormancy Biological Process
GO:0009908 flower development Biological Process
GO:0009909 regulation of flower development Biological Process
GO:0030154 cell differentiation Biological Process
GO:0031048 regulatory ncRNA-mediated heterochromatin formation Biological Process
GO:0048510 regulation of timing of transition from vegetative to reproductive phase Biological Process
GO:0080113 regulation of seed growth Biological Process
GO:0000785 chromatin Cellular Component
GO:0005634 nucleus Cellular Component
KEGG gene cross-reference
ath:AT4G16280
dosa:Os09g0123200
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.609
Rank 1 · TkA05G005250 · TK1151
Cytoplasm0.477
Rank 2 · TkA05G005250 · TK1151
Cell membrane0.062
Rank 3 · TkA05G005250 · TK1151
Endoplasmic reticulum0.035
Rank 4 · TkA05G005250 · TK1151
Lysosome / Vacuole0.027
Rank 5 · TkA05G005250 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07576BRAP286-149 aa
PF29326RRM_MUD2_C88-112 aa
PF16367RRM_790-116 aa
PF00076RRM_191-154 aa
PF28976RRM_ACIN191-165 aa
PF08777RRM_391-152 aa
PF28441RRM_1193-178 aa
PF05172RRM_Nup3593-160 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA05G005250PF07576BRAP2861490.1413.1
TkA05G005250PF29326RRM_MUD2_C881120.1812.6
TkA05G005250PF16367RRM_7901160.005617.3
TkA05G005250PF00076RRM_1911542.2e-31108.2
TkA05G005250PF28976RRM_ACIN1911653.3e-0524.6
TkA05G005250PF08777RRM_3911520.003518.1
TkA05G005250PF28441RRM_11931780.0001322.9
TkA05G005250PF05172RRM_Nup35931600.06713.9
TkA05G005250PF16842RRM_occluded961550.0215.5
TkA05G005250PF29326RRM_MUD2_C1261540.1812.6
TkA05G005250PF16367RRM_71872270.005617.3
TkA05G005250PF00076RRM_11892532.2e-31108.2
TkA05G005250PF08777RRM_31912540.003518.1
TkA05G005250PF28441RRM_111982450.0001322.9
TkA05G005250PF16842RRM_occluded1992230.0215.5
TkA05G005250PF05172RRM_Nup352032330.06713.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
O04425Arabidopsis thalianasp|O04425|FCA_ARATH Flowering time control protein FCA47.200%Swiss-ProtMedium
Q8GZ26Arabidopsis thalianasp|Q8GZ26|BRN2L_ARATH RNA-binding protein BRN234.800%Swiss-ProtMedium
Q8LFS6Arabidopsis thalianasp|Q8LFS6|BRN1L_ARATH RNA-binding protein BRN130.700%Swiss-ProtMedium
B8BCZ8Oryza sativa subsp. indicasp|B8BCZ8|FCA_ORYSI Flowering time control protein FCA49.700%Swiss-ProtMedium
Q6K271Oryza sativa subsp. japonicasp|Q6K271|FCA_ORYSJ Flowering time control protein FCA49.700%Swiss-ProtMedium

JBrowse

View in Genome Browser