TkA04G518450 | RubberDandelionOmics

Gene overview

TkA04G518450

Reference: TK1151 Chr: Chr04 Coordinates: 131140336-131141139 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

804 bp · TkA04G518450|TK1151|cDNA

ATGAAACACCACATAGGGATTCGAGAGAAGTGGAAGGGACTCATCGGGAAGCGACCACAATGCAAGGAGAAAGTACGAGGCCGGTGGACACGTCTCCACACAAAAAAATTAATGGCATTAATGACTGGTGGCGGTGACCCCACGCCACATGTCCCTTACAACAACGATACTAGCTATGGAATCAATTCGGAACCATCCTTACCCGTTAGTTATGGGCCACTTCATGGACTACCCATGGGCTGTTTTGGCCCATTTCCATC...

CDS

Download CDS FASTA

804 bp · TkA04G518450|TK1151|CDS

ATGAAACACCACATAGGGATTCGAGAGAAGTGGAAGGGACTCATCGGGAAGCGACCACAATGCAAGGAGAAAGTACGAGGCCGGTGGACACGTCTCCACACAAAAAAATTAATGGCATTAATGACTGGTGGCGGTGACCCCACGCCACATGTCCCTTACAACAACGATACTAGCTATGGAATCAATTCGGAACCATCCTTACCCGTTAGTTATGGGCCACTTCATGGACTACCCATGGGCTGTTTTGGCCCATTTCCATC...

Protein

Download Protein FASTA

267 aa · TkA04G518450|TK1151|PROTEIN

MKHHIGIREKWKGLIGKRPQCKEKVRGRWTRLHTKKLMALMTGGGDPTPHVPYNNDTSYGINSEPSLPVSYGPLHGLPMGCFGPFPSTPQFNIGSHQILRPNPPNALGKKKRNFKSGGLSTNLFSKLISTTTTTFNTNPQVIIEVHPNEVEHTEKETVRINNDEAEATITVDDNNGVEAEINSVPITFNTNSPTSTDVNSNGEGHNEKETVSLNIDEAEATIVINDIIESEAEMTAKIGKCVGFDIEADNPILLEVLGES...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G518450`
TK1151 ID	TkA04G518450
OH-1004 ID	LXL04_016671
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	63.900
Protein coverage (%)	TK1151 85.019 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G518450`
Location	Chr04:131140336-131141139 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_016671` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.590

Rank 1 · TkA04G518450 · TK1151

Cytoplasm0.404

Rank 2 · TkA04G518450 · TK1151

Cell membrane0.052

Rank 3 · TkA04G518450 · TK1151

Mitochondrion0.034

Rank 4 · TkA04G518450 · TK1151

Endoplasmic reticulum0.030

Rank 5 · TkA04G518450 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28742SECTM1_Ig134-169 aa

PF02210Laminin_G_2136-193 aa

PF02001DUF134137-173 aa

PF24966Ig_TR130_2nd138-175 aa

PF28742SECTM1_Ig180-230 aa

PF24966Ig_TR130_2nd199-229 aa

PF02001DUF134203-237 aa

PF02210Laminin_G_2206-235 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G518450	`PF28742`	SECTM1_Ig	134	169	0.1	13.4
TkA04G518450	`PF02210`	Laminin_G_2	136	193	0.25	12.5
TkA04G518450	`PF02001`	DUF134	137	173	0.0046	18.2
TkA04G518450	`PF24966`	Ig_TR130_2nd	138	175	1.5	10.3
TkA04G518450	`PF28742`	SECTM1_Ig	180	230	0.1	13.4
TkA04G518450	`PF24966`	Ig_TR130_2nd	199	229	1.5	10.3
TkA04G518450	`PF02001`	DUF134	203	237	0.0046	18.2
TkA04G518450	`PF02210`	Laminin_G_2	206	235	0.25	12.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card