TkA04G505210 | RubberDandelionOmics

Gene overview

TkA04G505210

Reference: TK1151 Chr: Chr04 Coordinates: 127614282-127616081 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

930 bp · TkA04G505210|TK1151|cDNA

ATGAAAGGCGATTTCCATGTCGTTGTGGTTATTGTAATTATCGCTACAATTCTTCTATTGACAGGAAATACAGGAAAACGAGGAAGAGGGATTAGGGTTATACGCCAGGCGCCGACTAAGATTAGGTTTCCGAAATCAATTTCATCGCTTGAATTCGGAGATTTTGAAGCTCTTCTCCATCGCTTGATTTGTCACTGGAGATTTCAAGTGAGTGAATTCACAAGGCGGGTCCCTGCTCTGGCACTTCGTCTTCTTCGTCG...

CDS

Download CDS FASTA

930 bp · TkA04G505210|TK1151|CDS

ATGAAAGGCGATTTCCATGTCGTTGTGGTTATTGTAATTATCGCTACAATTCTTCTATTGACAGGAAATACAGGAAAACGAGGAAGAGGGATTAGGGTTATACGCCAGGCGCCGACTAAGATTAGGTTTCCGAAATCAATTTCATCGCTTGAATTCGGAGATTTTGAAGCTCTTCTCCATCGCTTGATTTGTCACTGGAGATTTCAAGTGAGTGAATTCACAAGGCGGGTCCCTGCTCTGGCACTTCGTCTTCTTCGTCG...

Protein

Download Protein FASTA

309 aa · TkA04G505210|TK1151|PROTEIN

MKGDFHVVVVIVIIATILLLTGNTGKRGRGIRVIRQAPTKIRFPKSISSLEFGDFEALLHRLICHWRFQVSEFTRRVPALALRLLRRTELQKLEQELWNLKMQGSDINRYTNRFNELATLCPGMVTPMARKIERYIGGMSPQIQNSVTAFNPLTYESVKSVAVRMTDQAVRNGTMPTKAEPSREQHKRKFWSNNNNNNNSNNNNNNSNNNNNNNRQITTQAPPKRPHTNNVYAAVPVNVVAPQKQYAGNLPMCNKCNLHH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G505210`
TK1151 ID	TkA04G505210
OH-1004 ID	LXL04_023213
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	81.100
Protein coverage (%)	TK1151 61.489 / OH-1004 16.709 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G505210`
Location	Chr04:127614282-127616081 (+)
Description	Similar to pol: Retrovirus-related Pol polyprotein from transposon 17.6
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_023213` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006281 DNA repair Biological Process GO:0006310 DNA recombination Biological Process GO:0006313 DNA transposition Biological Process GO:0006508 proteolysis Biological Process GO:0015074 DNA integration Biological Process GO:0075523 viral translational frameshifting Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0042575 DNA polymerase complex Cellular Component GO:0003676 nucleic acid binding Molecular Function GO:0003677 DNA binding Molecular Function GO:0003723 RNA binding Molecular Function
KEGG gene cross-reference	sce:YGR109W-B sce:YIL082W-A These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.447

Rank 1 · TkA04G505210 · TK1151

Nucleus0.408

Rank 2 · TkA04G505210 · TK1151

Mitochondrion0.098

Rank 3 · TkA04G505210 · TK1151

Cell membrane0.073

Rank 4 · TkA04G505210 · TK1151

Endoplasmic reticulum0.064

Rank 5 · TkA04G505210 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27960NCMAP7-47 aa

PF26045OB_2TM_halo59-90 aa

PF19259Ty3_capsid86-169 aa

PF05053Menin89-120 aa

PF26045OB_2TM_halo130-170 aa

PF25671T4_Tape_measure139-238 aa

PF08704GCD14142-228 aa

PF29740DDB_G0287209_N185-214 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G505210	`PF27960`	NCMAP	7	47	0.52	11.0
TkA04G505210	`PF26045`	OB_2TM_halo	59	90	0.08	13.5
TkA04G505210	`PF19259`	Ty3_capsid	86	169	1.4e-06	28.6
TkA04G505210	`PF05053`	Menin	89	120	7.2	5.5
TkA04G505210	`PF26045`	OB_2TM_halo	130	170	0.08	13.5
TkA04G505210	`PF25671`	T4_Tape_measure	139	238	4.2	6.9
TkA04G505210	`PF08704`	GCD14	142	228	0.0011	19.4
TkA04G505210	`PF29740`	DDB_G0287209_N	185	214	0.46	8.9
TkA04G505210	`PF05053`	Menin	185	224	7.2	5.5
TkA04G505210	`PF22575`	Vir1p	185	217	9.0	4.6
TkA04G505210	`PF27960`	NCMAP	216	216	0.52	11.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card