TkA04G465200 | RubberDandelionOmics

Gene overview

TkA04G465200

Reference: TK1151 Chr: Chr04 Coordinates: 117445536-117447143 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1464 bp · TkA04G465200|TK1151|cDNA

GTCGGTGTTTCCACATGAAACAACGTGTATATTTTTATTATGAAAATATCTTATAAAATTGCAAAAACAATGACGTGTCGACACGTAGGATCTGATCGTACAATTCTGATCTCTATCTTCACTGAAAGCTTTCCTCTTTCTCCTATAAATTAGTGACGTTTTTTCATCAAAGCCAGGTACACAACAACAACAACTAATCATAACCATTTTGCTATTTAGTTTACAGTCACATTAATGGCGAACGATATCGTTAATGGCGG...

CDS

Download CDS FASTA

669 bp · TkA04G465200|TK1151|CDS

ATGGCGAACGATATCGTTAATGGCGGAAAACAGATCATCGAGCAGGAGGAGGAGCCATTAGTCACTTCATCATCTTCATTGCAGCAAATGCCTCTCTTATCTCTCAATCACGTCTCCTTCATCTGCAAATCCGTTCGTCAATCAGTCAAGTTTTACAGCGATGTTCTCGGATTTGTTCTTATTAGACGTCCATCTTCTTTCGACTTCGAAGGTGCTTGGTTGTTCAACGATGGGATTGGAATACATTTGCTAGAAGTGGA...

Protein

Download Protein FASTA

222 aa · TkA04G465200|TK1151|PROTEIN

MANDIVNGGKQIIEQEEEPLVTSSSSLQQMPLLSLNHVSFICKSVRQSVKFYSDVLGFVLIRRPSSFDFEGAWLFNDGIGIHLLEVETTPTKTGSINPKDNHISFQCTDMDLIIKKLEKLDIKYVTAVVKEGGVEVNQLFFHDPDGYMIEICNCHVLPVLPITSCPLKKLPAAQQINNGGFSFYGIGHVKNGEKMTSKDYVCGEDEVLMMDNFLVDIMGISF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G465200`
TK1151 ID	TkA04G465200
OH-1004 ID	LXL04_038785
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G465200

Location Chr04:117445536-117447143 (+)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g15380`	Involved in the detoxification and scavenging of methylglyoxal (MG), a cytotoxic aldehyde produced in response to primary metabolism alteration observed during biotic and abiotic stresses.	Genome-wide association study reveals novel players in defense hormone crosstalk in Arabidopsis.2018 · DOI: 10.1111/pce.13357 GLYI4 Plays A Role in Methylglyoxal Detoxification and Jasmonate-Mediated Stress Responses in Arabidopsis thaliana .2019 · DOI: 10.3390/biom9100635

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038785 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0009408 response to heat Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009611 response to wounding Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0009787 regulation of abscisic acid-activated signaling pathway Biological Process

GO:0010045 response to nickel cation Biological Process

GO:0010224 response to UV-B Biological Process

GO:0051595 response to methylglyoxal Biological Process

KEGG gene cross-reference

ath:AT1G15380

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.378

Rank 1 · TkA04G465200 · TK1151

Nucleus0.243

Rank 2 · TkA04G465200 · TK1151

Cell membrane0.196

Rank 3 · TkA04G465200 · TK1151

Endoplasmic reticulum0.153

Rank 4 · TkA04G465200 · TK1151

Golgi apparatus0.141

Rank 5 · TkA04G465200 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00903Glyoxalase35-151 aa

PF13669Glyoxalase_436-132 aa

PF18029Glyoxalase_639-150 aa

PF12681Glyoxalase_240-153 aa

PF22677Ble-like_N48-62 aa

PF18638CyRPA75-151 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G465200	`PF00903`	Glyoxalase	35	151	4.3e-15	56.9
TkA04G465200	`PF13669`	Glyoxalase_4	36	132	0.00013	22.9
TkA04G465200	`PF18029`	Glyoxalase_6	39	150	0.067	14.6
TkA04G465200	`PF12681`	Glyoxalase_2	40	153	4.2e-07	30.6
TkA04G465200	`PF22677`	Ble-like_N	48	62	0.026	15.0
TkA04G465200	`PF18638`	CyRPA	75	151	0.044	13.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XI31`	Arabidopsis thaliana	sp\|Q9XI31\|GLYI4_ARATH Glyoxylase I 4	61.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card