TkA04G326030 | RubberDandelionOmics

Gene overview

TkA04G326030

Reference: TK1151 Chr: Chr04 Coordinates: 82428887-82431180 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

885 bp · TkA04G326030|TK1151|cDNA

GTCTGATTAGTGTGCAAGTGTGAACATATATGCATTAACTGAAGCTATAAAACTAGCTGTAAGGATTTCGTTGTAGGTAAATATTAGGCAGGAATTATGGAATCCAACCCTAGTTCATCGTCTTCTAGGGCTGACAGAAGAACCATTGAGAAAAACAGAAGGATGCAAATGAAGGCCCTCTACTCCAAGCTCCACTCTCTTGTTCCTCATAACTCTTCTAGGGAAGTGATCACATCACTGCCAGATCAACTACAAGAAGC...

CDS

Download CDS FASTA

561 bp · TkA04G326030|TK1151|CDS

ATGGAATCCAACCCTAGTTCATCGTCTTCTAGGGCTGACAGAAGAACCATTGAGAAAAACAGAAGGATGCAAATGAAGGCCCTCTACTCCAAGCTCCACTCTCTTGTTCCTCATAACTCTTCTAGGGAAGTGATCACATCACTGCCAGATCAACTACAAGAAGCTGCAAATTACATAAAGAAATTGCAAATAAAACTGGAGAAAATGAACGAAGAAAAGGATAATTTGATGGGAATCAAGAAACTGGAGATTAATCGTGA...

Protein

Download Protein FASTA

186 aa · TkA04G326030|TK1151|PROTEIN

MESNPSSSSSRADRRTIEKNRRMQMKALYSKLHSLVPHNSSREVITSLPDQLQEAANYIKKLQIKLEKMNEEKDNLMGIKKLEINREDKIKSSNMTVGQQRMPQVDVRGSGSSLEAILITGIDFQFLFSETIRVIHEEGFDVINATFSVLNDTVFHTIHAQIGENYAQDNGISRITERLNNIAYGI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G326030`
TK1151 ID	TkA04G326030
OH-1004 ID	LXL04_025563
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	28.700
Protein coverage (%)	TK1151 80.645 / OH-1004 64.220 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G326030

Location Chr04:82428887-82431180 (+)

Description Similar to BHLH162: Transcription factor bHLH162

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g20970`	Transcription factor bHLH162.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025563 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0005634 nucleus Cellular Component

GO:0090575 RNA polymerase II transcription regulator complex Cellular Component

GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding Molecular Function

GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0046983 protein dimerization activity Molecular Function

KEGG gene cross-reference

ath:AT4G20970

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.862

Rank 1 · TkA04G326030 · TK1151

Cytoplasm0.256

Rank 2 · TkA04G326030 · TK1151

Cell membrane0.031

Rank 3 · TkA04G326030 · TK1151

Endoplasmic reticulum0.024

Rank 4 · TkA04G326030 · TK1151

Plastid0.011

Rank 5 · TkA04G326030 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26095CC_Bre110-76 aa

PF00010HLH11-63 aa

PF23174bHLH_ILI24-77 aa

PF16218Peptidase_C10136-127 aa

PF26471DUF814648-89 aa

PF26095CC_Bre1134-155 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G326030	`PF26095`	CC_Bre1	10	76	0.027	15.5
TkA04G326030	`PF00010`	HLH	11	63	9.4e-08	32.5
TkA04G326030	`PF23174`	bHLH_ILI	24	77	0.025	15.7
TkA04G326030	`PF16218`	Peptidase_C101	36	127	0.0081	16.3
TkA04G326030	`PF26471`	DUF8146	48	89	0.015	16.2
TkA04G326030	`PF26095`	CC_Bre1	134	155	0.027	15.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JIJ7`	Arabidopsis thaliana	sp\|F4JIJ7\|BH162_ARATH Transcription factor bHLH162	44.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card