TkA04G264130 | RubberDandelionOmics

Gene overview

TkA04G264130

Reference: TK1151 Chr: Chr04 Coordinates: 66830261-66834472 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1813 bp · TkA04G264130|TK1151|cDNA

GGCTTTTTCTTTTTCTCCACACTTCTCTACATGGCCTGATGGTATCCACGTTTCTGGCTTTCTGCTATGACTAAACCGGCCGGTTTACTCTTAGCTCTTAAACCTCGACACTTCTGATTCTAATTTCTAAACCCTAGAAGCAGAAAACATACAAAAAGTGTAGAAATGTTGGAGAGCAGATTGATTTCAATTATAAGGAGGAGCAAATCTATCAATCAGATAAGATCGTCGTATTCTTCTCACGGTGGATCGACGAATCT...

CDS

Download CDS FASTA

873 bp · TkA04G264130|TK1151|CDS

ATGAATATTGATGATTTTAAATTCATATACTGGATGGAGTACGCGCATCGTATGTGGGGAAGGGCATTAGGGATCATGTTTGCGCTTCCATTTTCGTATTTTATACGAAAAGGTTATATTAATTTAAGGCTTGGAGTTAGGCTTGCTGGTTTATTTGCTCTTGGTGGTGGACAAGGGTTGATTGGTTGGTGGATGGTTAAAAGTGGTTTAGAAGAGCCACCTTCCGAATACTCACAACCAAGAGTGAGTCCATACCGCCT...

Protein

Download Protein FASTA

290 aa · TkA04G264130|TK1151|PROTEIN

MNIDDFKFIYWMEYAHRMWGRALGIMFALPFSYFIRKGYINLRLGVRLAGLFALGGGQGLIGWWMVKSGLEEPPSEYSQPRVSPYRLAAHLTSAFAIYCGLFWTALSAVMPEPPTESMAWVNGAAKVKRLAIPVGILVGVTAVSGAFVAGNDAGHAFNTFPKMGDSWIPEGVLSMKPIIRNFFENTATVQLDHRILATATLAAITGLWWSTRKVDLHPAIRSLIGSTMGMAALQVTLGISTLLSYVPVSLGTAHQAGALT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G264130`
TK1151 ID	TkA04G264130
OH-1004 ID	LXL04_037250
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 62.635 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G264130

Location Chr04:66830261-66834472 (-)

Description Similar to COX15: Cytochrome c oxidase assembly protein COX15

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g56090`	Catalyzes the second reaction in the biosynthesis of heme A, a prosthetic group of mitochondrial cytochrome c oxidase (CcO).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037250 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006783 heme biosynthetic process Biological Process

GO:0006784 heme A biosynthetic process Biological Process

GO:0017004 cytochrome complex assembly Biological Process

GO:0005654 nucleoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0070069 cytochrome complex Cellular Component

GO:0098803 respiratory chain complex Cellular Component

GO:0016627 oxidoreductase activity, acting on the CH-CH group of donors Molecular Function

GO:0016653 oxidoreductase activity, acting on NAD(P)H, heme protein as acceptor Molecular Function

KEGG gene cross-reference

ath:AT5G56090

bta:517811

hsa:1355

mmu:226139

nmu:Nmul_A1204

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.958

Rank 1 · TkA04G264130 · TK1151

Cytoplasm0.042

Rank 2 · TkA04G264130 · TK1151

Nucleus0.033

Rank 3 · TkA04G264130 · TK1151

Cell membrane0.031

Rank 4 · TkA04G264130 · TK1151

Endoplasmic reticulum0.023

Rank 5 · TkA04G264130 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02628COX15-CtaA1-265 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G264130	`PF02628`	COX15-CtaA	1	265	2.6e-85	287.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FKT8`	Arabidopsis thaliana	sp\|Q9FKT8\|COX15_ARATH Heme A synthase COX15	81.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card