TkA04G226990 | RubberDandelionOmics

Gene overview

TkA04G226990

Reference: TK1151 Chr: Chr04 Coordinates: 57740358-57744393 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

612 bp · TkA04G226990|TK1151|cDNA

CCATATTTACCCTCCTGTAAATTGAAAGATGATTTAATCGATGCAATATTTCCTTCTTTGCACATCAATGGAGGATCTTCAGATTATATTATTTCGAGGGCGATATTATTAACAAAAAACGAAAATATCGACGAAATTAACGATCAAATGATTGATAGTGGTTTGCCCCCTCACTACCTACGGCTTAAAATCGGATGTCCTATAATTCTGTTACGGAATATTGATCCTTCCAATGGATTATGTAATGGCACAAGATTGAT...

CDS

Download CDS FASTA

612 bp · TkA04G226990|TK1151|CDS

CCATATTTACCCTCCTGTAAATTGAAAGATGATTTAATCGATGCAATATTTCCTTCTTTGCACATCAATGGAGGATCTTCAGATTATATTATTTCGAGGGCGATATTATTAACAAAAAACGAAAATATCGACGAAATTAACGATCAAATGATTGATAGTGGTTTGCCCCCTCACTACCTACGGCTTAAAATCGGATGTCCTATAATTCTGTTACGGAATATTGATCCTTCCAATGGATTATGTAATGGCACAAGATTGAT...

Protein

Download Protein FASTA

203 aa · TkA04G226990|TK1151|PROTEIN

PYLPSCKLKDDLIDAIFPSLHINGGSSDYIISRAILLTKNENIDEINDQMIDSGLPPHYLRLKIGCPIILLRNIDPSNGLCNGTRLICKGFQMNVIDTEIVVRHHAGKIVFLPRIPLCPSANDMFSLKLKRKQFLIRLSFAMMINKVQGQSLSNAGLFFIEPVFTHDQLYVSFSRVKSRDELKILIFDKDNRITNKTSNVVFK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G226990`
TK1151 ID	TkA04G226990
OH-1004 ID	LXL04_039659
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	95.500
Protein coverage (%)	TK1151 99.015 / OH-1004 36.086 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G226990`
Location	Chr04:57740358-57744393 (+)
Description	Similar to E2FF: E2F transcription factor-like E2FF
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_039659` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process GO:0001117 protein-DNA-RNA complex disassembly Biological Process GO:0006281 DNA repair Biological Process GO:0006310 DNA recombination Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006357 regulation of transcription by RNA polymerase II Biological Process GO:0007004 telomere maintenance via telomerase Biological Process GO:0008284 positive regulation of cell population proliferation Biological Process GO:0009733 response to auxin Biological Process GO:0032211 negative regulation of telomere maintenance via telomerase Biological Process GO:0032466 negative regulation of cytokinesis Biological Process GO:0032876 negative regulation of DNA endoreduplication Biological Process
KEGG gene cross-reference	ath:AT3G01330 ath:AT3G48160 ath:AT5G14960 dre:565952 hsa:80119 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.349

Rank 1 · TkA04G226990 · TK1151

Peroxisome0.129

Rank 2 · TkA04G226990 · TK1151

Nucleus0.108

Rank 3 · TkA04G226990 · TK1151

Extracellular0.102

Rank 4 · TkA04G226990 · TK1151

Mitochondrion0.056

Rank 5 · TkA04G226990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21530Pif1_2B_dom53-88 aa

PF02689Herpes_Helicase136-184 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G226990	`PF21530`	Pif1_2B_dom	53	88	1.6e-17	63.7
TkA04G226990	`PF02689`	Herpes_Helicase	136	184	0.05	12.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card