TkA04G226960 | RubberDandelionOmics

Gene overview

TkA04G226960

Reference: TK1151 Chr: Chr04 Coordinates: 57724413-57729800 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3766 bp · TkA04G226960|TK1151|cDNA

AAATGCTCTAAGCTCACCAATCACCATACTTCCTCTAACCTCAACTGAAGTGAAAGGACCAAGGAGCACCCACATATACCAACTCTAAACCTTCGTACTTTGACCTTTTTCACTGTAAAAAGTCCCCCAAAGCCAAATCTTTCGAAAAGTAAAGGCGCTTCCCTCTTCCCCATCTGAACTCCAACAATACATTCGAAAATATAGAAAAAAAGCCTTCGAATCCACCAAAACAGTAGCAGTGTGACTTCATACCCTCGGGA...

CDS

Download CDS FASTA

2919 bp · TkA04G226960|TK1151|CDS

ATGTTCTATTCTCAGTTTATATTAGCGAAAAAGGGCCCCTTGGGAACAATATGGATTGCCGCTCATTTGGAGCGAAAGCTTCGCAAAAATCAGGTTTCAGATACCGATATCGGTGTCTCTGTTGACTCGATCCTTTTTCCGGAAATGCCGATTGCGCTCCGGTTATCTAGCCATCTTCTACTGGGCGTGGTTCGAATATATTCAAAGAAGGTAAGTTACCTCTTTGACGATTGTAGCGAGGCGCTGTTAAAAGTAAAAAA...

Protein

Download Protein FASTA

972 aa · TkA04G226960|TK1151|PROTEIN

MFYSQFILAKKGPLGTIWIAAHLERKLRKNQVSDTDIGVSVDSILFPEMPIALRLSSHLLLGVVRIYSKKVSYLFDDCSEALLKVKNAFRANAVDLPPEESTAPYHAITLPETFDLDDFELPDNENLQGNFVDHHVGARDQITLQDTMEGVVYSTSDFGRDERFGDGEASHLDLNEDLVAEKVETAGNTNVDPEAKTPDKEDENDLSDDDGVDQDQMEDSDGYDDGDADYVPEEYTEGPSTPGLWEEPNLSKVEETPTCV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G226960`
TK1151 ID	TkA04G226960
OH-1004 ID	LXL04_039369
Relationship / confidence	Rbh High Identity Coverage Local Synteny Minor Chr Pair / Probable
Protein identity (%)	97.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G226960

Location Chr04:57724413-57729800 (+)

Description Similar to SYN4: Sister chromatid cohesion 1 protein 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g16270`	Involved in sister chromatid and centromere cohesion during mitosis.	Cohesin gene defects may impair sister chromatid alignment and genome stability in Arabidopsis thaliana.2009 · DOI: 10.1007/s00412-009-0220-x
`At3g59550`	May be involved in sister chromatid cohesion during mitosis.	No verified direct reference in this release
`At5g40840`	May be involved in sister chromatid cohesion during mitosis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039369 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0001666 response to hypoxia Biological Process

GO:0006302 double-strand break repair Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0007059 chromosome segregation Biological Process

GO:0007062 sister chromatid cohesion Biological Process

GO:0010628 positive regulation of gene expression Biological Process

GO:0010629 negative regulation of gene expression Biological Process

GO:0010972 negative regulation of G2/M transition of mitotic cell cycle Biological Process

GO:0032691 negative regulation of interleukin-1 beta production Biological Process

GO:0032720 negative regulation of tumor necrosis factor production Biological Process

GO:0032733 positive regulation of interleukin-10 production Biological Process

KEGG gene cross-reference

ath:AT5G16270

bta:540966

mmu:19357

xla:399129

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.955

Rank 1 · TkA04G226960 · TK1151

Cytoplasm0.154

Rank 2 · TkA04G226960 · TK1151

Cell membrane0.017

Rank 3 · TkA04G226960 · TK1151

Mitochondrion0.013

Rank 4 · TkA04G226960 · TK1151

Endoplasmic reticulum0.009

Rank 5 · TkA04G226960 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04825Rad21_Rec8_N1-101 aa

PF04824Rad21_Rec81-12 aa

PF06278CNDH2_N59-87 aa

PF06278CNDH2_N835-863 aa

PF04824Rad21_Rec8920-966 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G226960	`PF04825`	Rad21_Rec8_N	1	101	4.5e-38	130.5
TkA04G226960	`PF04824`	Rad21_Rec8	1	12	4.9e-19	68.1
TkA04G226960	`PF06278`	CNDH2_N	59	87	0.17	12.6
TkA04G226960	`PF06278`	CNDH2_N	835	863	0.17	12.6
TkA04G226960	`PF04824`	Rad21_Rec8	920	966	4.9e-19	68.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8W1Y0`	Arabidopsis thaliana	sp\|Q8W1Y0\|SSC14_ARATH Sister chromatid cohesion 1 protein 4	35.500%	Swiss-Prot	Medium
`Q9FQ19`	Arabidopsis thaliana	sp\|Q9FQ19\|SCC13_ARATH Sister chromatid cohesion 1 protein 3	48.600%	Swiss-Prot	Low
`Q9FQ20`	Arabidopsis thaliana	sp\|Q9FQ20\|SCC12_ARATH Sister chromatid cohesion 1 protein 2	42.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card