TkA04G116030 | RubberDandelionOmics

Gene overview

TkA04G116030

Reference: TK1151 Chr: Chr04 Coordinates: 30132259-30134148 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1154 bp · TkA04G116030|TK1151|cDNA

TTTAATTTCTATTCCCTACTTGCAGACTTACATGTGACATTGTTGGATTGGTTACTATTTAAGTACCTCTTCTTCTCCTCTTTCCGTATCATAATCATTATCTCCTTCTTATTCAGCCTTTTTTGCAGAGCAAAAATGGCGAAATCAGGGTTTCTTTTGCTAACCCTTTTATATATTCTTACACCTTATGTCCATGCTTTTACTGCTTCAGGCTGGACAAGAGCTCATGCCACCTTCTATGGAGGAAGTGATGCTTCCGG...

CDS

Download CDS FASTA

897 bp · TkA04G116030|TK1151|CDS

TTTAATTTCTATTCCCTACTTGCAGACTTACATGTGACATTGTTGGATTGGTTACTATTTAAGTACCTCTTCTTCTCCTCTTTCCGTATCATAATCATTATCTCCTTCTTATTCAGCCTTTTTTGCAGAGCAAAAATGGCGAAATCAGGGTTTCTTTTGCTAACCCTTTTATATATTCTTACACCTTATGTCCATGCTTTTACTGCTTCAGGCTGGACAAGAGCTCATGCCACCTTCTATGGAGGAAGTGATGCTTCCGG...

Protein

Download Protein FASTA

298 aa · TkA04G116030|TK1151|PROTEIN

FNFYSLLADLHVTLLDWLLFKYLFFSSFRIIIIISFLFSLFCRAKMAKSGFLLLTLLYILTPYVHAFTASGWTRAHATFYGGSDASGTMGGACGYGNLYSTGYGTRTAALSTALFNDGASCGQCYKLICDYKADPRWCIKGTSITITATNFCPPNFAQPSDDGGWCNPPRQHFDMAQPAWEKIGIYRGGIVPIIYQRVPCKKHGGVRFTINGRDYFELVLISNIGAAGSIQSVQVKGSKTGWMAMSRNWGANWQSNSYLN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G116030`
TK1151 ID	TkA04G116030
OH-1004 ID	LXL04_035685
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 95.638 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G116030

Location Chr04:30132259-30134148 (-)

Description Similar to EXPA1: Expansin-A1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g20190`	Causes loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0228400`	May cause loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release
`Os06g0718100`	May cause loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release
`Os02g0267200`	May cause loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release
`Os03g0155300`	May cause loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035685 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009826 unidimensional cell growth Biological Process

GO:0009828 plant-type cell wall loosening Biological Process

GO:0005576 extracellular region Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT1G20190

dosa:Os02g0267200

dosa:Os03g0155300

dosa:Os04g0228400

dosa:Os06g0718100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.393

Rank 1 · TkA04G116030 · TK1151

Lysosome / Vacuole0.288

Rank 2 · TkA04G116030 · TK1151

Cytoplasm0.166

Rank 3 · TkA04G116030 · TK1151

Endoplasmic reticulum0.137

Rank 4 · TkA04G116030 · TK1151

Cell membrane0.058

Rank 5 · TkA04G116030 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29515Expansin_N29-42 aa

PF22514EXPB1_D177-202 aa

PF29515Expansin_N80-153 aa

PF03330DPBB_1107-195 aa

PF01357Expansin_C206-283 aa

PF06865Ppnp254-290 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G116030	`PF29515`	Expansin_N	29	42	1.4e-08	35.6
TkA04G116030	`PF22514`	EXPB1_D1	77	202	6.4e-08	33.8
TkA04G116030	`PF29515`	Expansin_N	80	153	1.4e-08	35.6
TkA04G116030	`PF03330`	DPBB_1	107	195	4.6e-22	78.8
TkA04G116030	`PF01357`	Expansin_C	206	283	3e-27	95.3
TkA04G116030	`PF06865`	Ppnp	254	290	0.12	13.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LNU3`	Arabidopsis thaliana	sp\|Q9LNU3\|EXP11_ARATH Expansin-A11	71.800%	Swiss-Prot	High
`Q7XWU8`	Oryza sativa subsp. japonica	sp\|Q7XWU8\|EXPA1_ORYSJ Expansin-A1	77.700%	Swiss-Prot	High
`Q4PR39`	Oryza sativa subsp. japonica	sp\|Q4PR39\|EXP29_ORYSJ Expansin-A29	69.700%	Swiss-Prot	High
`Q4PR52`	Oryza sativa subsp. japonica	sp\|Q4PR52\|EXP13_ORYSJ Expansin-A13	72.900%	Swiss-Prot	High
`Q7G6Z2`	Oryza sativa subsp. japonica	sp\|Q7G6Z2\|EXP12_ORYSJ Expansin-A12	72.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card