TkA04G095200 | RubberDandelionOmics

Gene overview

TkA04G095200

Reference: TK1151 Chr: Chr04 Coordinates: 24793955-24796162 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1350 bp · TkA04G095200|TK1151|cDNA

CAGTGTACGAAAGTGTTAAGAGATGGAGAAAGCAGCAAGAAGACAAGGAAAAGTCGTGGAAAATCTGGTGCTGACGTAAGGGGGACCAGGAAGGCCCAACAGCAACAAAGCAGGTTTCGGGCATTAAGGGAAGAGTTGCAGGGCCCACCATCACGCACCAGGGCTAGCCTCAAGAGAAGACTCCATGAACCTTCTTCATCAACAAAACTCCAGGTAGAAAAGAAACTAAAGCAAGAAGATAAAACGCACATCGAAGAGCA...

CDS

Download CDS FASTA

1350 bp · TkA04G095200|TK1151|CDS

CAGTGTACGAAAGTGTTAAGAGATGGAGAAAGCAGCAAGAAGACAAGGAAAAGTCGTGGAAAATCTGGTGCTGACGTAAGGGGGACCAGGAAGGCCCAACAGCAACAAAGCAGGTTTCGGGCATTAAGGGAAGAGTTGCAGGGCCCACCATCACGCACCAGGGCTAGCCTCAAGAGAAGACTCCATGAACCTTCTTCATCAACAAAACTCCAGGTAGAAAAGAAACTAAAGCAAGAAGATAAAACGCACATCGAAGAGCA...

Protein

Download Protein FASTA

449 aa · TkA04G095200|TK1151|PROTEIN

QCTKVLRDGESSKKTRKSRGKSGADVRGTRKAQQQQSRFRALREELQGPPSRTRASLKRRLHEPSSSTKLQVEKKLKQEDKTHIEEHEENPTLGAPSINQPLPDKQTLEHIIDILQRKDIYEIFAEPVDPEEVEDYYEIIEEPMDFGTMRAKLHEGMYTSLQQFEHDVFLISGNAMHFNSSGTIFFRQAHAIHKLAKRVFHVLRTNPESFESEFSGTRRRSCRRSQDNEFNFNSKSFLKTTEKTSTGGSRDGNICDSIEA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G095200`
TK1151 ID	TkA04G095200
OH-1004 ID	LXL04_022238
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	47.900
Protein coverage (%)	TK1151 26.503 / OH-1004 20.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G095200`
Location	Chr04:24793955-24796162 (-)
Description	Similar to Brpf3: Bromodomain and PHD finger-containing protein 3
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_022238` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006271 DNA strand elongation involved in DNA replication Biological Process GO:0006338 chromatin remodeling Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0006357 regulation of transcription by RNA polymerase II Biological Process GO:0035726 common myeloid progenitor cell proliferation Biological Process GO:0035902 response to immobilization stress Biological Process GO:0045740 positive regulation of DNA replication Biological Process GO:0045893 positive regulation of DNA-templated transcription Biological Process GO:0048145 regulation of fibroblast proliferation Biological Process GO:0050793 regulation of developmental process Biological Process GO:0051602 response to electrical stimulus Biological Process
KEGG gene cross-reference	dme:Dmel_CG1845 hsa:23774 hsa:27154 mmu:268936 mmu:78783 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.967

Rank 1 · TkA04G095200 · TK1151

Cytoplasm0.088

Rank 2 · TkA04G095200 · TK1151

Cell membrane0.023

Rank 3 · TkA04G095200 · TK1151

Plastid0.012

Rank 4 · TkA04G095200 · TK1151

Endoplasmic reticulum0.012

Rank 5 · TkA04G095200 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25289DUF787715-42 aa

PF09468RNase_H2-Ydr27948-116 aa

PF25289DUF787757-82 aa

PF25289DUF7877104-173 aa

PF00439Bromodomain109-190 aa

PF09468RNase_H2-Ydr279249-271 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G095200	`PF25289`	DUF7877	15	42	0.05	14.8
TkA04G095200	`PF09468`	RNase_H2-Ydr279	48	116	0.12	13.6
TkA04G095200	`PF25289`	DUF7877	57	82	0.05	14.8
TkA04G095200	`PF25289`	DUF7877	104	173	0.05	14.8
TkA04G095200	`PF00439`	Bromodomain	109	190	1e-22	80.6
TkA04G095200	`PF09468`	RNase_H2-Ydr279	249	271	0.12	13.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card