TkA04G080930 | RubberDandelionOmics

Gene overview

TkA04G080930

Reference: TK1151 Chr: Chr04 Coordinates: 21249060-21251738 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1969 bp · TkA04G080930|TK1151|cDNA

AAAAACGACATTGCAGCGGTCCATCACCTTCTTCATGACTTATATATAACCTCGCGTTGGCCAGTCCTTTCTTTCATCACTTCCTCATCGATCCATCTATTCACCGGCCGTCTCTCAATCTCAACCCAAAAACTAAGCATCCCATCAATGGAGCGTTGGGTTCGAGCTTTAGTGTTGGTGGGCTTCATACTCCCGCTGTTGGTGGAGGGTAGAGTTCGTCGCTATAATTTCAATGTGGTCGCGAAAACAGCAAGTCGATT...

CDS

Download CDS FASTA

1818 bp · TkA04G080930|TK1151|CDS

AAAAACGACATTGCAGCGGTCCATCACCTTCTTCATGACTTATATATAACCTCGCGTTGGCCAGTCCTTTCTTTCATCACTTCCTCATCGATCCATCTATTCACCGGCCGTCTCTCAATCTCAACCCAAAAACTAAGCATCCCATCAATGGAGCGTTGGGTTCGAGCTTTAGTGTTGGTGGGCTTCATACTCCCGCTGTTGGTGGAGGGTAGAGTTCGTCGCTATAATTTCAATGTGGTCGCGAAAACAGCAAGTCGATT...

Protein

Download Protein FASTA

605 aa · TkA04G080930|TK1151|PROTEIN

KNDIAAVHHLLHDLYITSRWPVLSFITSSSIHLFTGRLSISTQKLSIPSMERWVRALVLVGFILPLLVEGRVRRYNFNVVAKTASRLCSTKPIVTVNGQFPGPTLYAREGDTVLVRVVNHVKYNVSIHWHGIRQLRSGWADGPAYITQCPIQPGQNYVYNFTITGQRGTLFWHAHILWLRATVHGAIVILPKLGVPYPFPKPDVEQVVILGEWWKSDTEAVINQALKSGLAPNISDAHTINGHPGPTSACQTQGGFQVSV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G080930`
TK1151 ID	TkA04G080930
OH-1004 ID	LXL04_027589
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	61.400
Protein coverage (%)	TK1151 90.744 / OH-1004 97.345 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G080930

Location Chr04:21249060-21251738 (-)

Description Similar to LAC11: Laccase-11

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g38080`	Lignin degradation and detoxification of lignin-derived products (By similarity).	No verified direct reference in this release
`At5g01190`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release
`At5g58910`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release
`At5g03260`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os11g0708100`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027589 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009809 lignin biosynthetic process Biological Process

GO:0009834 plant-type secondary cell wall biogenesis Biological Process

GO:0046274 lignin catabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0048046 apoplast Cellular Component

GO:0005507 copper ion binding Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

GO:0052716 hydroquinone:oxygen oxidoreductase activity Molecular Function

KEGG gene cross-reference

ath:AT2G38080

ath:AT5G03260

ath:AT5G58910

osa:107276614

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.835

Rank 1 · TkA04G080930 · TK1151

Cytoplasm0.057

Rank 2 · TkA04G080930 · TK1151

Cell membrane0.040

Rank 3 · TkA04G080930 · TK1151

Endoplasmic reticulum0.038

Rank 4 · TkA04G080930 · TK1151

Lysosome / Vacuole0.028

Rank 5 · TkA04G080930 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07732Cu-oxidase_380-192 aa

PF00394Cu-oxidase94-119 aa

PF07731Cu-oxidase_2103-178 aa

PF00394Cu-oxidase206-354 aa

PF07732Cu-oxidase_3259-272 aa

PF07731Cu-oxidase_2285-329 aa

PF14952zf-tcix408-423 aa

PF07732Cu-oxidase_3412-432 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G080930	`PF07732`	Cu-oxidase_3	80	192	9.4e-44	149.0
TkA04G080930	`PF00394`	Cu-oxidase	94	119	3.9e-45	154.5
TkA04G080930	`PF07731`	Cu-oxidase_2	103	178	1.4e-46	158.4
TkA04G080930	`PF00394`	Cu-oxidase	206	354	3.9e-45	154.5
TkA04G080930	`PF07732`	Cu-oxidase_3	259	272	9.4e-44	149.0
TkA04G080930	`PF07731`	Cu-oxidase_2	285	329	1.4e-46	158.4
TkA04G080930	`PF14952`	zf-tcix	408	423	0.3	11.4
TkA04G080930	`PF07732`	Cu-oxidase_3	412	432	9.4e-44	149.0
TkA04G080930	`PF07731`	Cu-oxidase_2	456	588	1.4e-46	158.4
TkA04G080930	`PF00394`	Cu-oxidase	534	588	3.9e-45	154.5
TkA04G080930	`PF07732`	Cu-oxidase_3	547	587	9.4e-44	149.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80434`	Arabidopsis thaliana	sp\|O80434\|LAC4_ARATH Laccase-4	74.300%	Swiss-Prot	High
`Q6ID18`	Arabidopsis thaliana	sp\|Q6ID18\|LAC10_ARATH Laccase-10	71.300%	Swiss-Prot	High
`Q1PDH6`	Arabidopsis thaliana	sp\|Q1PDH6\|LAC16_ARATH Laccase-16	68.300%	Swiss-Prot	High
`Q8VZA1`	Arabidopsis thaliana	sp\|Q8VZA1\|LAC11_ARATH Laccase-11	62.900%	Swiss-Prot	High
`Q0IQU1`	Oryza sativa subsp. japonica	sp\|Q0IQU1\|LAC22_ORYSJ Laccase-22	67.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card