TkA03G575280 | RubberDandelionOmics

Gene overview

TkA03G575280

Reference: TK1151 Chr: Chr03 Coordinates: 145896842-145897903 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1062 bp · TkA03G575280|TK1151|cDNA

ATGAAAAGAGAAAGAACGGCCATCATAAGATTAGATTCAACTTTGAGCCTTCCAATACGTACCAAAACCCCTCAAAACACTCAAACCCCGAGAATTTTAGTTGAAGAAATCGGTGGCCTAATTAGGGTTTACAAAGATGGACACGTGGAAAGACCCCAAATCGTTCCATTTGTGACGTGTACATTACCCCTCGAACTCGGTGTAACATGCAAAGATCTAGTAATCGACACGTTTACAAACATTTGGGCTCGTTTTTATGT...

CDS

Download CDS FASTA

1062 bp · TkA03G575280|TK1151|CDS

ATGAAAAGAGAAAGAACGGCCATCATAAGATTAGATTCAACTTTGAGCCTTCCAATACGTACCAAAACCCCTCAAAACACTCAAACCCCGAGAATTTTAGTTGAAGAAATCGGTGGCCTAATTAGGGTTTACAAAGATGGACACGTGGAAAGACCCCAAATCGTTCCATTTGTGACGTGTACATTACCCCTCGAACTCGGTGTAACATGCAAAGATCTAGTAATCGACACGTTTACAAACATTTGGGCTCGTTTTTATGT...

Protein

Download Protein FASTA

353 aa · TkA03G575280|TK1151|PROTEIN

MKRERTAIIRLDSTLSLPIRTKTPQNTQTPRILVEEIGGLIRVYKDGHVERPQIVPFVTCTLPLELGVTCKDLVIDTFTNIWARFYVPKSNEKLPLLVYFHGGGFCVGSAAWSCYHEFLALLARKAGCLIMSVNYRLAPENPLPAAYEDGEKALMWVKQQALSGNPNKLWWLKNCDFSNVFLAGDSAGGNIAHNTTLRLCANWGKLKPLIIKGNILIQPFFGGESRTNSEAYMVQPPGSALNLVASDTYWRLSLPKGVNR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G575280`
TK1151 ID	TkA03G575280
OH-1004 ID	LXL04_011235
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G575280

Location Chr03:145896842-145897903 (+)

Description Similar to CXE6: Probable carboxylesterase 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g68620`	Carboxylesterase acting on esters with varying acyl chain length.	No verified direct reference in this release
`At5g16080`	Carboxylesterase acting on esters with varying acyl chain length.	No verified direct reference in this release
`At5g06570`	May bind strigolactones and catalyze their hydrolysis.	Catabolism of strigolactones by a carboxylesterase.2021 · DOI: 10.1038/s41477-021-01011-y Structural insights into strigolactone catabolism by carboxylesterases reveal a conserved conformational regulation.2024 · DOI: 10.1038/s41467-024-50928-3
`At5g62180`	Carboxylesterase that possesses esterase activity in vitro with the synthetic substrate p-nitrophenyl acetate (pNPA).	Arabidopsis Carboxylesterase 20 Binds Strigolactone and Increases Branches and Tillers When Ectopically Expressed in Arabidopsis and Maize.2021 · DOI: 10.3389/fpls.2021.639401 Structural insights into strigolactone catabolism by carboxylesterases reveal a conserved conformational regulation.2024 · DOI: 10.1038/s41467-024-50928-3

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011235 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0071456 cellular response to hypoxia Biological Process

GO:1901600 strigolactone metabolic process Biological Process

GO:2000032 regulation of secondary shoot formation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0043722 4-hydroxyphenylacetate decarboxylase activity Molecular Function

GO:0052689 carboxylic ester hydrolase activity Molecular Function

GO:0106435 carboxylesterase activity Molecular Function

KEGG gene cross-reference

ath:AT1G68620

ath:AT5G06570

ath:AT5G16080

ath:AT5G62180

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.692

Rank 1 · TkA03G575280 · TK1151

Nucleus0.312

Rank 2 · TkA03G575280 · TK1151

Plastid0.066

Rank 3 · TkA03G575280 · TK1151

Peroxisome0.064

Rank 4 · TkA03G575280 · TK1151

Endoplasmic reticulum0.059

Rank 5 · TkA03G575280 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05448AXE180-111 aa

PF20434BD-FAE86-193 aa

PF00135COesterase86-214 aa

PF07224Chlorophyllase87-206 aa

PF10340Say1_Mug18088-223 aa

PF07859Abhydrolase_397-324 aa

PF05448AXE1174-192 aa

PF10340Say1_Mug180251-296 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G575280	`PF05448`	AXE1	80	111	0.18	11.3
TkA03G575280	`PF20434`	BD-FAE	86	193	1.2e-12	48.6
TkA03G575280	`PF00135`	COesterase	86	214	5.5e-09	36.2
TkA03G575280	`PF07224`	Chlorophyllase	87	206	0.29	10.6
TkA03G575280	`PF10340`	Say1_Mug180	88	223	1.1e-06	28.5
TkA03G575280	`PF07859`	Abhydrolase_3	97	324	4.1e-58	197.3
TkA03G575280	`PF05448`	AXE1	174	192	0.18	11.3
TkA03G575280	`PF10340`	Say1_Mug180	251	296	1.1e-06	28.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SX25`	Arabidopsis thaliana	sp\|Q9SX25\|CXE6_ARATH Probable carboxylesterase 6	52.500%	Swiss-Prot	High
`Q9LFR7`	Arabidopsis thaliana	sp\|Q9LFR7\|CXE17_ARATH Probable carboxylesterase 17	51.900%	Swiss-Prot	High
`Q9FG13`	Arabidopsis thaliana	sp\|Q9FG13\|CXE15_ARATH Strigolactones hydrolase CXE15	38.000%	Swiss-Prot	Medium
`Q9LVB8`	Arabidopsis thaliana	sp\|Q9LVB8\|CXE20_ARATH Carboxylesterase 20	38.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card