TkA03G550030 | RubberDandelionOmics

Gene overview

TkA03G550030

Reference: TK1151 Chr: Chr03 Coordinates: 139226366-139228752 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2001 bp · TkA03G550030|TK1151|cDNA

TGTTTCATAAAAAGCCTCCCATCCTTGATTATTTTATCACTTCTATTTCCCTCACAGGTAAGCAAAAATGGTCAATTCTTTCACGTATGGCCTAATACGCTTACTACTTCTCTCTGTTTTTGCTCATAACATGCTTCATGTTATGGCCCAATGGCCTAACGGTGGATCAACAAGATACTATGACTTCAAGGTACAAATGTTAAAAGTCAACAAACTTTGTCAAACGAGAGAAATAGTGACTATCACCCAGAAGTATCCCG...

CDS

Download CDS FASTA

1722 bp · TkA03G550030|TK1151|CDS

ATGGTCAATTCTTTCACGTATGGCCTAATACGCTTACTACTTCTCTCTGTTTTTGCTCATAACATGCTTCATGTTATGGCCCAATGGCCTAACGGTGGATCAACAAGATACTATGACTTCAAGGTACAAATGTTAAAAGTCAACAAACTTTGTCAAACGAGAGAAATAGTGACTATCACCCAGAAGTATCCCGGACCGGTTGTGTACGCACAAGAAGATGATAGAGTTATTGTCAAGCTAAAAAATGAGACACCATATAA...

Protein

Download Protein FASTA

573 aa · TkA03G550030|TK1151|PROTEIN

MVNSFTYGLIRLLLLSVFAHNMLHVMAQWPNGGSTRYYDFKVQMLKVNKLCQTREIVTITQKYPGPVVYAQEDDRVIVKLKNETPYNATIHWHGVRQILSCWSDGPSYITQCPVQSGQTFTYEFTLVKQKGTLFWHAHFSWLRATVYGAIIIYPKKGVPYPFIHPYEEHTVILGEYWNRDLVELERIVTASGGGAPVADAYTINGHPAPNYNCSTNDVYKINVVPGKTYMLRLIGALLNMESFFTIANHKLTIVEADGEY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G550030`
TK1151 ID	TkA03G550030
OH-1004 ID	LXL04_010817
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G550030

Location Chr03:139226366-139228752 (+)

Description Similar to LAC6: Laccase-6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g46570`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release
`At5g05390`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release
`At2g40370`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release
`At2g30210`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release
`At5g07130`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0842400`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release
`Os11g0708100`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010817 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009625 response to insect Biological Process

GO:0046274 lignin catabolic process Biological Process

GO:0046688 response to copper ion Biological Process

GO:1990641 response to iron ion starvation Biological Process

GO:0005576 extracellular region Cellular Component

GO:0048046 apoplast Cellular Component

GO:0048226 Casparian strip Cellular Component

GO:0005507 copper ion binding Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

GO:0052716 hydroquinone:oxygen oxidoreductase activity Molecular Function

KEGG gene cross-reference

ath:AT2G40370

ath:AT2G46570

ath:AT5G05390

dosa:Os01g0842400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.849

Rank 1 · TkA03G550030 · TK1151

Cell membrane0.062

Rank 2 · TkA03G550030 · TK1151

Cytoplasm0.058

Rank 3 · TkA03G550030 · TK1151

Endoplasmic reticulum0.046

Rank 4 · TkA03G550030 · TK1151

Golgi apparatus0.023

Rank 5 · TkA03G550030 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07732Cu-oxidase_342-156 aa

PF07731Cu-oxidase_263-141 aa

PF00394Cu-oxidase167-319 aa

PF07732Cu-oxidase_3198-223 aa

PF07731Cu-oxidase_2259-285 aa

PF00394Cu-oxidase434-554 aa

PF07731Cu-oxidase_2442-556 aa

PF05140ResB453-503 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G550030	`PF07732`	Cu-oxidase_3	42	156	3e-37	128.0
TkA03G550030	`PF07731`	Cu-oxidase_2	63	141	3.9e-45	153.7
TkA03G550030	`PF00394`	Cu-oxidase	167	319	3.8e-42	144.8
TkA03G550030	`PF07732`	Cu-oxidase_3	198	223	3e-37	128.0
TkA03G550030	`PF07731`	Cu-oxidase_2	259	285	3.9e-45	153.7
TkA03G550030	`PF00394`	Cu-oxidase	434	554	3.8e-42	144.8
TkA03G550030	`PF07731`	Cu-oxidase_2	442	556	3.9e-45	153.7
TkA03G550030	`PF05140`	ResB	453	503	0.091	12.2
TkA03G550030	`PF07732`	Cu-oxidase_3	471	483	3e-37	128.0
TkA03G550030	`PF07732`	Cu-oxidase_3	515	555	3e-37	128.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZPY2`	Arabidopsis thaliana	sp\|Q9ZPY2\|LAC6_ARATH Laccase-6	66.800%	Swiss-Prot	High
`Q9FLB5`	Arabidopsis thaliana	sp\|Q9FLB5\|LAC12_ARATH Laccase-12	51.000%	Swiss-Prot	High
`Q9SIY8`	Arabidopsis thaliana	sp\|Q9SIY8\|LAC5_ARATH Laccase-5	47.100%	Swiss-Prot	Medium
`Q56YT0`	Arabidopsis thaliana	sp\|Q56YT0\|LAC3_ARATH Laccase-3	49.300%	Swiss-Prot	Medium
`Q9LYQ2`	Arabidopsis thaliana	sp\|Q9LYQ2\|LAC13_ARATH Laccase-13	49.200%	Swiss-Prot	Medium
`Q5N9X2`	Oryza sativa subsp. japonica	sp\|Q5N9X2\|LAC4_ORYSJ Laccase-4	47.000%	Swiss-Prot	Medium
`Q0IQU1`	Oryza sativa subsp. japonica	sp\|Q0IQU1\|LAC22_ORYSJ Laccase-22	48.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card