TkA03G415230 | RubberDandelionOmics

Gene overview

TkA03G415230

Reference: TK1151 Chr: Chr03 Coordinates: 103276322-103278506 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1062 bp · TkA03G415230|TK1151|cDNA

CTTGTCTCTCTCTCCTCCTCAAATCATCCTCACCCCTCTTTCTCTCTCTCAAGAAGTAGGGATTAAAGCCAATTTCATAATCAAAATTGGAGTTTATTTGATCTCATCGATGCAATGGATAAAACAGAGAAACAAACGGATAAAAGGGAGAGGGCCAAAGAGCGTAGAGAGAAACGTCGTCAAGAGATCTCTCTAATCCGTTCAATTCCTTATTCAGATCACCAGAGATGGTGGTCAGCGGATACAATAGCAGTGGTGAC...

CDS

Download CDS FASTA

948 bp · TkA03G415230|TK1151|CDS

ATGGATAAAACAGAGAAACAAACGGATAAAAGGGAGAGGGCCAAAGAGCGTAGAGAGAAACGTCGTCAAGAGATCTCTCTAATCCGTTCAATTCCTTATTCAGATCACCAGAGATGGTGGTCAGCGGATACAATAGCAGTGGTGACGGGTGCAAATCGAGGAATTGGATTTGAAATTGCCCACCAACTTGGATTACACGGGTTAACAGTCGTTCTTACTTCAAGAGAAACCGCAGTAGGTGAAGAAGCAGCAAAAGTCCT...

Protein

Download Protein FASTA

316 aa · TkA03G415230|TK1151|PROTEIN

MDKTEKQTDKRERAKERREKRRQEISLIRSIPYSDHQRWWSADTIAVVTGANRGIGFEIAHQLGLHGLTVVLTSRETAVGEEAAKVLQEGGLKVVFHQLDVIDHESINTFCTWIKSNYGGIDILINNAGFNHNLGSDNSVELAEKVISTNYFGTKNMVKAAIPLMRANNAGARIVSVSSRLGRLNGRKNRISDDELRQQLEDVESLSEEKIDAVVNKFLEQVKDGSWVTGGWPQNNTDYALSKLAVNAYTRVVARELSGR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G415230`
TK1151 ID	TkA03G415230
OH-1004 ID	LXL04_031977
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	71.600
Protein coverage (%)	TK1151 99.051 / OH-1004 97.508 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G415230

Location Chr03:103276322-103278506 (+)

Description Similar to CBR1: Carbonyl reductase [NADPH] 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g61220`	Aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on saturated and alpha,beta-unsaturated aldehydes with more than 5 carbons.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031977 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006629 lipid metabolic process Biological Process

GO:0006706 steroid catabolic process Biological Process

GO:0006805 xenobiotic metabolic process Biological Process

GO:0008211 glucocorticoid metabolic process Biological Process

GO:0032355 response to estradiol Biological Process

GO:0032570 response to progesterone Biological Process

GO:0042373 vitamin K metabolic process Biological Process

GO:0042376 phylloquinone catabolic process Biological Process

GO:0046457 prostanoid biosynthetic process Biological Process

GO:1905344 prostaglandin catabolic process Biological Process

GO:2000379 positive regulation of reactive oxygen species metabolic process Biological Process

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

hsa:873

mmu:12408

ssc:397143

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.633

Rank 1 · TkA03G415230 · TK1151

Nucleus0.252

Rank 2 · TkA03G415230 · TK1151

Mitochondrion0.136

Rank 3 · TkA03G415230 · TK1151

Peroxisome0.098

Rank 4 · TkA03G415230 · TK1151

Cell membrane0.071

Rank 5 · TkA03G415230 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26211Phage_phiTE_07213-35 aa

PF00106adh_short45-184 aa

PF08659KR46-161 aa

PF01370Epimerase47-179 aa

PF04321RmlD_sub_bind47-178 aa

PF16363GDP_Man_Dehyd48-179 aa

PF13561adh_short_C250-182 aa

PF04055Radical_SAM63-107 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G415230	`PF26211`	Phage_phiTE_072	13	35	0.23	12.2
TkA03G415230	`PF00106`	adh_short	45	184	7.9e-39	133.9
TkA03G415230	`PF08659`	KR	46	161	1.4e-07	32.3
TkA03G415230	`PF01370`	Epimerase	47	179	2.5e-06	27.8
TkA03G415230	`PF04321`	RmlD_sub_bind	47	178	0.23	11.2
TkA03G415230	`PF16363`	GDP_Man_Dehyd	48	179	0.024	14.8
TkA03G415230	`PF13561`	adh_short_C2	50	182	2.4e-30	106.6
TkA03G415230	`PF04055`	Radical_SAM	63	107	0.055	14.3
TkA03G415230	`PF26211`	Phage_phiTE_072	187	240	0.23	12.2
TkA03G415230	`PF04055`	Radical_SAM	200	273	0.055	14.3
TkA03G415230	`PF13561`	adh_short_C2	231	282	2.4e-30	106.6
TkA03G415230	`PF00106`	adh_short	236	282	7.9e-39	133.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M2E2`	Arabidopsis thaliana	sp\|Q9M2E2\|SDR1_ARATH (+)-neomenthol dehydrogenase	38.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card