Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2305 bp · TkA03G332600|TK1151|cDNA
CTACGCAAATATCCCGCCAATAAAAAGTCGGGTCTCGTCTCCCTCAGTCTGCTTACCAAGATTTATTCCCCCAAAATTACACACCAGTAGAAAATCAAGTGAAGTCGTTGAAATCCTAGTCAAATTCGACGTTGTACTCACTTCAATCAGGAATGATCGTGTTGGAAGGTGGTCATGCTGACCACAAAGCAATATCAAATAACAGGCCAATCAGCCACTTATCAAATAGTGAACCAGATACCAACATGTGTGATCCAAAT...
1674 bp · TkA03G332600|TK1151|CDS
ATGATCGTGTTGGAAGGTGGTCATGCTGACCACAAAGCAATATCAAATAACAGGCCAATCAGCCACTTATCAAATAGTGAACCAGATACCAACATGTGTGATCCAAATGACCAAAATCTCATACAGGGCTTCAATGGAGACATGAGTCTTCAGGATATGTATAATAAGGAAGGTGATTTTGATAGTGAAGATGACAGTGACTGGGACCCTTTAGAGAAACCTTTAACAATTGCTAAATGGTTTTGTGTTAACTGTACGAT...
Protein
Download Protein FASTA557 aa · TkA03G332600|TK1151|PROTEIN
MIVLEGGHADHKAISNNRPISHLSNSEPDTNMCDPNDQNLIQGFNGDMSLQDMYNKEGDFDSEDDSDWDPLEKPLTIAKWFCVNCTMVNVDGAFYCHICGEHKESGILRHGFLASSSEKADSIQDISSQRNGKSEASCSKALPPRKMTAVGFDDRMLLHEEVERKSLPHPERPDRLRAIAASLATAGIFPGRCQPIAAREITREELQMVHSHENIESVELTSQCVASYFTPDTYANKDSALAARLAAGLCADLASAIYTG...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA03G332600 |
|---|---|
| TK1151 ID | TkA03G332600 |
| OH-1004 ID | LXL04_008790 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 95.100 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 96.223Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA03G332600 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr03:81779099-81785516 (+) | |||||||||
| Description | Similar to HDA15: Histone deacetylase 15 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process GO:0000183 rDNA heterochromatin formation Biological Process GO:0006325 chromatin organization Biological Process GO:0006338 chromatin remodeling Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006357 regulation of transcription by RNA polymerase II Biological Process GO:0009267 cellular response to starvation Biological Process GO:0009294 DNA-mediated transformation Biological Process GO:0009408 response to heat Biological Process GO:0009640 photomorphogenesis Biological Process GO:0009789 positive regulation of abscisic acid-activated signaling pathway Biological Process GO:0009908 flower development Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT3G18520 ath:AT5G61060 cal:CAALFM_CR02050CA sce:YNL021W spo:2540821 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF11682Zn_ribbon_1178-102 aaPF12773DZR82-102 aaPF00850Hist_deacetyl169-458 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA03G332600 | PF11682 | Zn_ribbon_11 | 78 | 102 | 0.15 | 12.6 |
| TkA03G332600 | PF12773 | DZR | 82 | 102 | 0.23 | 12.4 |
| TkA03G332600 | PF00850 | Hist_deacetyl | 169 | 458 | 1.2e-92 | 311.2 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.