TkA03G192150 | RubberDandelionOmics

Gene overview

TkA03G192150

Reference: TK1151 Chr: Chr03 Coordinates: 48355388-48359044 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2358 bp · TkA03G192150|TK1151|cDNA

TGAAGGGGCAGTTTTGACTTTTGCGGATGTTACCCACACATCTTCTGTACAAATCAAATTACCCGCTGACTTGACCCATTCGAAAGTGTCTTCTCAATGTCTAACCCTATACCGGTGAACATAATCTCCGACGACGACACAACCCCACTTCAGTTCAAATCCAAGAAACAAAGAGTTAGTTTTGATTCAAACTCTACGGCAGTCTTCATCATCGATGACGAACCAACTCCTCGCAAGCCATCGCCAAGTCCCTGCACTGC...

CDS

Download CDS FASTA

2061 bp · TkA03G192150|TK1151|CDS

ATGTCTAACCCTATACCGGTGAACATAATCTCCGACGACGACACAACCCCACTTCAGTTCAAATCCAAGAAACAAAGAGTTAGTTTTGATTCAAACTCTACGGCAGTCTTCATCATCGATGACGAACCAACTCCTCGCAAGCCATCGCCAAGTCCCTGCACTGCTTCGACGCCTTCGGTCGTACCCGAGACGCCCTCAGTTGCACCACAGACGCCTTCAGTCGTACCAGAGACGCCCATGGTGGAATCCCCGAAATCATA...

Protein

Download Protein FASTA

686 aa · TkA03G192150|TK1151|PROTEIN

MSNPIPVNIISDDDTTPLQFKSKKQRVSFDSNSTAVFIIDDEPTPRKPSPSPCTASTPSVVPETPSVAPQTPSVVPETPMVESPKSYVPIVRCNISVSDPQPRFSSSPNPKPSGLICLESDEECEGFGSFPEKINDRSSLTLEVENILEVPSTCSKSSMLHDRSFISPILEDELPQVSDHCGEEDDILDSKTTTKGNNVNKKRSDGELAGKSNEEKDQKESLKGVPLVRCNNSVSSSNPKSSGLICLESDEESEGFERFP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G192150`
TK1151 ID	TkA03G192150
OH-1004 ID	LXL04_007579
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G192150

Location Chr03:48355388-48359044 (-)

Description Similar to EME1B: Crossover junction endonuclease EME1B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g22140`	Interacts with MUS81 to form a DNA structure-specific endonuclease with substrate preference for branched DNA structures with a 5'-end at the branch nick.	Two distinct MUS81-EME1 complexes from Arabidopsis process Holliday junctions.2009 · DOI: 10.1104/pp.109.136846
`At2g21800`	Interacts with MUS81 to form a DNA structure-specific endonuclease with substrate preference for branched DNA structures with a 5'-end at the branch nick.	Two distinct MUS81-EME1 complexes from Arabidopsis process Holliday junctions.2009 · DOI: 10.1104/pp.109.136846

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0648700`	Interacts with MUS81 to form a DNA structure-specific endonuclease with substrate preference for branched DNA structures with a 5'-end at the branch nick.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007579 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000712 resolution of meiotic recombination intermediates Biological Process

GO:0006281 DNA repair Biological Process

GO:0006302 double-strand break repair Biological Process

GO:0006310 DNA recombination Biological Process

GO:0009411 response to UV Biological Process

GO:0009644 response to high light intensity Biological Process

GO:0010332 response to gamma radiation Biological Process

GO:0031297 replication fork processing Biological Process

GO:0031573 mitotic intra-S DNA damage checkpoint signaling Biological Process

GO:0051301 cell division Biological Process

GO:0005634 nucleus Cellular Component

GO:0048476 Holliday junction resolvase complex Cellular Component

KEGG gene cross-reference

ath:AT2G21800

ath:AT2G22140

dosa:Os04g0648700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.922

Rank 1 · TkA03G192150 · TK1151

Cytoplasm0.181

Rank 2 · TkA03G192150 · TK1151

Mitochondrion0.027

Rank 3 · TkA03G192150 · TK1151

Cell membrane0.021

Rank 4 · TkA03G192150 · TK1151

Endoplasmic reticulum0.008

Rank 5 · TkA03G192150 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28671UMP2335-386 aa

PF02732ERCC4391-547 aa

PF28671UMP2492-503 aa

PF21292EME1-MUS81_C588-659 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G192150	`PF28671`	UMP2	335	386	1.4	9.8
TkA03G192150	`PF02732`	ERCC4	391	547	4.1e-14	53.4
TkA03G192150	`PF28671`	UMP2	492	503	1.4	9.8
TkA03G192150	`PF21292`	EME1-MUS81_C	588	659	1.6e-09	38.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`C5H8J1`	Arabidopsis thaliana	sp\|C5H8J1\|EME1B_ARATH Crossover junction endonuclease EME1B	63.800%	Swiss-Prot	Low
`Q84M98`	Arabidopsis thaliana	sp\|Q84M98\|EME1A_ARATH Crossover junction endonuclease EME1A	58.500%	Swiss-Prot	Low
`Q0J9J6`	Oryza sativa subsp. japonica	sp\|Q0J9J6\|EME1_ORYSJ Crossover junction endonuclease EME1	51.500%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card