TkA03G122760 | RubberDandelionOmics

Gene overview

TkA03G122760

Reference: TK1151 Chr: Chr03 Coordinates: 31397687-31402118 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1296 bp · TkA03G122760|TK1151|cDNA

ATGAACCTGGGTACTAATATGAGTCTAGGGTTGAGAAAAGGAGCATGGACTAGGGAAGAAGATATTCGTCTCAAGGACTGCATTGAGAAACACGGCGAAGGGAAGTGGCACCTTATTCCTCTGAGAGCAGGGTTAAACAGGTGTAGAAAGAGCTGGAAGAAGAACCGAGCAACGGAATTACGGAAGTCATCGTCGATTGATCAGACGCAAAACGGCAAAAACTCGGCATTCGCAACTCTACAACTCTGCAAGCATAAATC...

CDS

Download CDS FASTA

1296 bp · TkA03G122760|TK1151|CDS

ATGAACCTGGGTACTAATATGAGTCTAGGGTTGAGAAAAGGAGCATGGACTAGGGAAGAAGATATTCGTCTCAAGGACTGCATTGAGAAACACGGCGAAGGGAAGTGGCACCTTATTCCTCTGAGAGCAGGGTTAAACAGGTGTAGAAAGAGCTGGAAGAAGAACCGAGCAACGGAATTACGGAAGTCATCGTCGATTGATCAGACGCAAAACGGCAAAAACTCGGCATTCGCAACTCTACAACTCTGCAAGCATAAATC...

Protein

Download Protein FASTA

431 aa · TkA03G122760|TK1151|PROTEIN

MNLGTNMSLGLRKGAWTREEDIRLKDCIEKHGEGKWHLIPLRAGLNRCRKSWKKNRATELRKSSSIDQTQNGKNSAFATLQLCKHKSVDSQIIDQFLIPHFLENIDDHVEEHIDDHVEEQEDVEVEQAEEQDPIEELVDIYDPRMWDKLNSEKIKLLVEKVEELKSLGLDIDDMRGQGYDNGANMKGKEKGVQNRFLNLNPRAFYTPSVIWYQVLNQVNVVSKRLQSKDMHLDIAISELNKLIEFFKDYRETGFSKAIDE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G122760`
TK1151 ID	TkA03G122760
OH-1004 ID	LXL04_037136
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	56.400
Protein coverage (%)	TK1151 46.404 / OH-1004 63.733 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G122760

Location Chr03:31397687-31402118 (-)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g66380`	Transcription activator, when associated with BHLH002/EGL3/MYC146, BHLH012/MYC1, or BHLH042/TT8.	No verified direct reference in this release
`At1g66370`	Transcription activator, when associated with BHLH002/EGL3/MYC146, BHLH012/MYC1, or BHLH042/TT8.	No verified direct reference in this release
`At1g66390`	Transcription activator, when associated with BHLH12/MYC1, EGL3, or GL3.	No verified direct reference in this release
`At1g56650`	Transcription activator, when associated with BHLH12/MYC1, EGL3, or GL3.	Sucrose-specific induction of anthocyanin biosynthesis in Arabidopsis requires the MYB75/PAP1 gene.2005 · DOI: 10.1104/pp.105.066688

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037136 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source) No functional description available

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.857

Rank 1 · TkA03G122760 · TK1151

Cytoplasm0.255

Rank 2 · TkA03G122760 · TK1151

Mitochondrion0.033

Rank 3 · TkA03G122760 · TK1151

Cell membrane0.023

Rank 4 · TkA03G122760 · TK1151

Endoplasmic reticulum0.016

Rank 5 · TkA03G122760 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00249Myb_DNA-binding13-51 aa

PF13921Myb_DNA-bind_616-40 aa

PF14291DUF4371101-101 aa

PF00249Myb_DNA-binding128-149 aa

PF14291DUF4371162-191 aa

PF13921Myb_DNA-bind_6190-202 aa

PF14291DUF4371214-265 aa

PF13921Myb_DNA-bind_6241-256 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G122760	`PF00249`	Myb_DNA-binding	13	51	2.6e-15	57.0
TkA03G122760	`PF13921`	Myb_DNA-bind_6	16	40	0.0085	17.0
TkA03G122760	`PF14291`	DUF4371	101	101	0.0012	19.2
TkA03G122760	`PF00249`	Myb_DNA-binding	128	149	2.6e-15	57.0
TkA03G122760	`PF14291`	DUF4371	162	191	0.0012	19.2
TkA03G122760	`PF13921`	Myb_DNA-bind_6	190	202	0.0085	17.0
TkA03G122760	`PF14291`	DUF4371	214	265	0.0012	19.2
TkA03G122760	`PF13921`	Myb_DNA-bind_6	241	256	0.0085	17.0
TkA03G122760	`PF00249`	Myb_DNA-binding	349	368	2.6e-15	57.0
TkA03G122760	`PF13921`	Myb_DNA-bind_6	350	368	0.0085	17.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FNV8`	Arabidopsis thaliana	sp\|Q9FNV8\|MY114_ARATH Transcription factor MYB114	77.300%	Swiss-Prot	Low
`Q9FNV9`	Arabidopsis thaliana	sp\|Q9FNV9\|MY113_ARATH Transcription factor MYB113	76.200%	Swiss-Prot	Low
`Q9ZTC3`	Arabidopsis thaliana	sp\|Q9ZTC3\|MYB90_ARATH Transcription factor MYB90	77.300%	Swiss-Prot	Low
`Q9FE25`	Arabidopsis thaliana	sp\|Q9FE25\|MYB75_ARATH Transcription factor MYB75	75.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card