TkA03G080700 | RubberDandelionOmics

Gene overview

TkA03G080700

Reference: TK1151 Chr: Chr03 Coordinates: 20568218-20570247 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1223 bp · TkA03G080700|TK1151|cDNA

TCCATCCAAAACCTAGAAAACTTTAAGAAACGTATTGTCATATTCGGCCCCATAACCATTTCCTTGTTTCAAAATTGTTCCCAAAAATTTTGGATTCGGATTTTTCCATCGCTATTTCCGACCACGACACACTTATAAATAGTCTTTAATAGGGCAAAATACACATATGTTAATGATCGTTATAGAGAAATAGAAAGACAAAGGACTAAATATGACAAGTAACTAATCCTAAGAACTACTTTTGTAAACTACTCTGCTGC...

CDS

Download CDS FASTA

618 bp · TkA03G080700|TK1151|CDS

ATGGAGTTAATGGAGGCATCTTCACATCCTTCTCCTGCTCTCTCTGCCGTTAGTCCACAACGCCATTTCTATCTCGCCGTCGACAGAATCCAGTTTAAGATGGAGACAATGGTGGATCTATTAGGAATGGCAGGACGTCGTCCATGGCTGCCAATGGTGGTTTGTTGCAGCACACGTGATGACCTTGACGCCGTTTGCTCAGCCATCTCCAACATCTCTTACATTTCTGTTACACCCCTGTACAGTGACCTCACTGAAGC...

Protein

Download Protein FASTA

205 aa · TkA03G080700|TK1151|PROTEIN

MELMEASSHPSPALSAVSPQRHFYLAVDRIQFKMETMVDLLGMAGRRPWLPMVVCCSTRDDLDAVCSAISNISYISVTPLYSDLTEAERSLILDKFRYATTKWNQNSAIQSGDEIEEQKSHMIVTTDTCLPLLSSGESPLSCIVLINYELPTKKETYMRRMTTCLAADGIVINMVVGGEVVTLKSIEESSNLVIAEMPINIFEMF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G080700`
TK1151 ID	TkA03G080700
OH-1004 ID	LXL04_006849
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G080700`
Location	Chr03:20568218-20570247 (+)
Description	Similar to EIF4-A: Eukaryotic initiation factor 4A
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_006849` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000184 nuclear-transcribed mRNA catabolic process, nonsense-mediated decay Biological Process GO:0000398 mRNA splicing, via spliceosome Biological Process GO:0001666 response to hypoxia Biological Process GO:0002183 cytoplasmic translational initiation Biological Process GO:0006417 regulation of translation Biological Process GO:0051028 mRNA transport Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005730 nucleolus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0010494 cytoplasmic stress granule Cellular Component
KEGG gene cross-reference	ath:AT3G19760 cel:CELE_F57B9.6 vpo:Kpol_1060p58 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.566

Rank 1 · TkA03G080700 · TK1151

Cytoplasm0.423

Rank 2 · TkA03G080700 · TK1151

Lysosome / Vacuole0.059

Rank 3 · TkA03G080700 · TK1151

Cell membrane0.057

Rank 4 · TkA03G080700 · TK1151

Golgi apparatus0.054

Rank 5 · TkA03G080700 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00271Helicase_C34-100 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G080700	`PF00271`	Helicase_C	34	100	0.00021	22.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card