TkA02G609110 | RubberDandelionOmics

Gene overview

TkA02G609110

Reference: TK1151 Chr: Chr02 Coordinates: 157091876-157094671 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1823 bp · TkA02G609110|TK1151|cDNA

ATTATACGAGACATGTCATAGTCGTTGAGGGGGCTTTATGCTTATAAAGTTTGTGAGGCTACTTCATAATCAAATTTGATTCGGCGTCCTTCTCTTTGTGGCGTAAAGAGCGTTTTTCTCAATTCCCTTGATCTCCAAGCAAATTGGAAACACAAATTCTTCAATAAAAGCTGCGATCAAAAGGATTAAGTTCCTATTGGTCAAAGTTTTGAATTGAAGGGAGATGGTAAAGAAGAACGAATCGAACCAGTATGATCACC...

CDS

Download CDS FASTA

1251 bp · TkA02G609110|TK1151|CDS

ATGGTAAAGAAGAACGAATCGAACCAGTATGATCACCATAGTTTGTTTACCGACTCCGATCAATCTTCAGGGAATGCTATACATGAATTTGTAGTTGAGTTGATGTCTGAATCGTCAACCATGGCTGAACCCATTAAACCTCCGCCGCAACAGCCTACGCCAACGAAGATGAATGACAAATTAGGGCTTTGCGAAAGAGCGTTATCCGCCGCTGGCGCCGCCTTCCTCTCCGCCATTATTGTTAACCCTCTTGATGTGGC...

Protein

Download Protein FASTA

416 aa · TkA02G609110|TK1151|PROTEIN

MVKKNESNQYDHHSLFTDSDQSSGNAIHEFVVELMSESSTMAEPIKPPPQQPTPTKMNDKLGLCERALSAAGAAFLSAIIVNPLDVAKTRLQAQAAGVAYSHPMTNLTSRMAVFGPNMMFADLRCSPSCTRAGIHGTVSICPPDCFEYKGTLDVFYKIIRQEGVARLWRGTNAGLALAIPTVGIYLPCYDMFRNWFEEFASENAPSMTPYAPLLAGSLSRSLACTTCYPIELARTRMQAFKDFNNGKKAPGVWKMLVEVL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G609110`
TK1151 ID	TkA02G609110
OH-1004 ID	LXL04_011845
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G609110

Location Chr02:157091876-157094671 (+)

Description Similar to MTM1: Mitochondrial carrier protein MTM1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g27940`	Involved in the mitochondrial activation of MSD1 by specifically facilitating insertion of the essential manganese cofactor.	AtMTM1, a novel mitochondrial protein, may be involved in activation of the manganese-containing superoxide dismutase in Arabidopsis.2007 · DOI: 10.1007/s00425-007-0547-6

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011845 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006783 heme biosynthetic process Biological Process

GO:0006828 manganese ion transport Biological Process

GO:0006879 intracellular iron ion homeostasis Biological Process

GO:0031921 pyridoxal phosphate transport Biological Process

GO:0071281 cellular response to iron ion Biological Process

GO:0097501 stress response to metal ion Biological Process

GO:0160007 glutathione import into mitochondrion Biological Process

GO:1901562 response to paraquat Biological Process

GO:1990542 mitochondrial transmembrane transport Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT4G27940

rno:296813

rno:360636

sce:YGR257C

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.890

Rank 1 · TkA02G609110 · TK1151

Cytoplasm0.046

Rank 2 · TkA02G609110 · TK1151

Nucleus0.037

Rank 3 · TkA02G609110 · TK1151

Cell membrane0.025

Rank 4 · TkA02G609110 · TK1151

Plastid0.018

Rank 5 · TkA02G609110 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00153Mito_carr62-101 aa

PF00153Mito_carr150-197 aa

PF00153Mito_carr207-309 aa

PF00153Mito_carr323-411 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G609110	`PF00153`	Mito_carr	62	101	1.8e-52	175.8
TkA02G609110	`PF00153`	Mito_carr	150	197	1.8e-52	175.8
TkA02G609110	`PF00153`	Mito_carr	207	309	1.8e-52	175.8
TkA02G609110	`PF00153`	Mito_carr	323	411	1.8e-52	175.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q944H5`	Arabidopsis thaliana	sp\|Q944H5\|MTM1_ARATH Mitochondrial carrier protein MTM1	72.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card