TkA02G506880 | RubberDandelionOmics

Gene overview

TkA02G506880

Reference: TK1151 Chr: Chr02 Coordinates: 130026761-130029711 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2057 bp · TkA02G506880|TK1151|cDNA

AAAGAAACAGATGTCACAGAACACAGTATTCGCAATTATTGAATCCCCTCTTCGTTATTATCCTGATGCTGACAGATGTCACAGAACACAGTAGTCGCAATTATTGAATCCCCTCTTCGTTATTATCCTGATGCTGCATCAGCTCTGACGATTTCTCAACTAAACAAACATTTGAAGCCTAACTAGTTTGATCTCTCAAAGTCTACATATACTGATATACATAACATAGTAGGCGCTGATTGTTACTTTTTGCAGAAATA...

CDS

Download CDS FASTA

1608 bp · TkA02G506880|TK1151|CDS

ATGGCTGCTCGGAGAATGTCATCGCTGCTTTCTTCTTCTTACGCCCCTGCTCTCTTACGATCGTTAGACCGCTACTCTGGCCGAGGCACAGGCATCACTAGGTTTAGTACAACAGCTGCTGCTTTAGAAGAACCAATAGTTCCACCCGTCACGGTTGAATACAACAAGCTCCTCATTAATGGACAATTTGTGGATGCAGCATCCGGGAAGACTTTTCCAACCTTAGATCCGAGAACAGGGGAATTGATTACCCATGTTGC...

Protein

Download Protein FASTA

535 aa · TkA02G506880|TK1151|PROTEIN

MAARRMSSLLSSSYAPALLRSLDRYSGRGTGITRFSTTAAALEEPIVPPVTVEYNKLLINGQFVDAASGKTFPTLDPRTGELITHVAEGDIEDVNRAVSAARKAFDEGPWPRMTAYERSRILYRFADLVEKHADEITALEVWDNGKPYDQAARHEIPLFIRLFRYYAGWADKIHGLTIQADGPYHVQTLHEPIGVAAQIIPWNFPLLIYAWKVGAALACGNTIVLKTAEQTPLSALYVSNLFHEAGLPPGVLNIVSGFGP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G506880`
TK1151 ID	TkA02G506880
OH-1004 ID	LXL04_013299
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 94.690 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G506880

Location Chr02:130026761-130029711 (+)

Description Similar to ALDH2B4: Aldehyde dehydrogenase family 2 member B4, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g48000`	Possesses activity on acetaldehyde and glycolaldehyde in vitro.	No verified direct reference in this release
`At1g23800`	Possesses activity on acetaldehyde and glycolaldehyde in vitro.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013299 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002931 response to ischemia Biological Process

GO:0006067 ethanol metabolic process Biological Process

GO:0006068 ethanol catabolic process Biological Process

GO:0006117 acetaldehyde metabolic process Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0010597 green leaf volatile biosynthetic process Biological Process

GO:0018937 nitroglycerin metabolic process Biological Process

GO:0019752 carboxylic acid metabolic process Biological Process

GO:0032355 response to estradiol Biological Process

GO:0032496 response to lipopolysaccharide Biological Process

GO:0032570 response to progesterone Biological Process

GO:0032870 cellular response to hormone stimulus Biological Process

KEGG gene cross-reference

ath:AT1G23800

ath:AT3G48000

mmu:11669

rno:29539

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.819

Rank 1 · TkA02G506880 · TK1151

Cytoplasm0.090

Rank 2 · TkA02G506880 · TK1151

Plastid0.068

Rank 3 · TkA02G506880 · TK1151

Peroxisome0.049

Rank 4 · TkA02G506880 · TK1151

Nucleus0.034

Rank 5 · TkA02G506880 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00171Aldedh63-525 aa

PF00936BMC80-105 aa

PF23969DUF7296305-344 aa

PF00936BMC315-328 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G506880	`PF00171`	Aldedh	63	525	1.3e-171	572.0
TkA02G506880	`PF00936`	BMC	80	105	0.18	12.5
TkA02G506880	`PF23969`	DUF7296	305	344	0.23	12.7
TkA02G506880	`PF00936`	BMC	315	328	0.18	12.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SU63`	Arabidopsis thaliana	sp\|Q9SU63\|AL2B4_ARATH Aldehyde dehydrogenase family 2 member B4, mitochondrial	74.700%	Swiss-Prot	High
`Q8S528`	Arabidopsis thaliana	sp\|Q8S528\|AL2B7_ARATH Aldehyde dehydrogenase family 2 member B7, mitochondrial	75.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card