TkA02G379150 | RubberDandelionOmics

Gene overview

TkA02G379150

Reference: TK1151 Chr: Chr02 Coordinates: 96395092-96401278 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2127 bp · TkA02G379150|TK1151|cDNA

GCTTTCGGTTCAACGTGTTTAGAAAGCCGCCCTAACGTCCGTTCATCCATTCATCTTCTTCGATCAACTGCTCAACTCACAGCTTTCTCCTTTGCACCATCATCTACGCTAACTCGCACCTTCACCTCTCTCGATCTTCTTGCCTTCTCTCATCGTTTCCTCGTTACTAATCTACAACTAATCACATTTCAGGCTCTTTTGGAAGTGAGATCTCATCATCCAATTGTAGCTGAATAGATGGAGAACCAGGATGAAATCCC...

CDS

Download CDS FASTA

822 bp · TkA02G379150|TK1151|CDS

ATGGTGGAGAGATTCTTTTCCATTAACTCCCCCAATTTACACGATAATTCAATGATGCTCCTATCTGGCCCTCCCTCTTCAGGGAAGACATCTCTGCTATTTCAGTTTGCATTCAATTCCGTCGTTCATGGCGATGATAAATCAGTCGTTTTCATTTGTAACAGACGCAAATTAGGTAACAAGCCCCCTTTTCTCTCTCAGGGCATTGATCCATCTTCTCATGTATTCGATCGCATCGAAATGAAGTATGTAGATGAAGA...

Protein

Download Protein FASTA

273 aa · TkA02G379150|TK1151|PROTEIN

MVERFFSINSPNLHDNSMMLLSGPPSSGKTSLLFQFAFNSVVHGDDKSVVFICNRRKLGNKPPFLSQGIDPSSHVFDRIEMKYVDEEGINKFFAAFHMHDTFPVSVIIDDLGEFFDERNCQQRYRSPRGRELAIARTLALCRNAINHAKPGLCGLFGPVFTEFAHSETGPCMLMFSDTHHGDTPRLFHIYKRWIDSIFTIKADGVGSFILKNNGSLRGSCGLEMVRTKMDLMDLHCQWREGKYCGRWWKNEKEKGSGKSR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G379150`
TK1151 ID	TkA02G379150
OH-1004 ID	LXL04_014982
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	90.800
Protein coverage (%)	TK1151 83.516 / OH-1004 90.213 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G379150`
Location	Chr02:96395092-96401278 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_014982` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.474

Rank 1 · TkA02G379150 · TK1151

Cytoplasm0.345

Rank 2 · TkA02G379150 · TK1151

Mitochondrion0.086

Rank 3 · TkA02G379150 · TK1151

Peroxisome0.065

Rank 4 · TkA02G379150 · TK1151

Endoplasmic reticulum0.059

Rank 5 · TkA02G379150 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00270DEAD11-58 aa

PF20720nSTAND313-45 aa

PF06745ATPase13-51 aa

PF03796DnaB_C13-51 aa

PF13555AAA_2913-33 aa

PF13191AAA_1614-37 aa

PF24883NPHP3_N14-56 aa

PF01637ATPase_216-57 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G379150	`PF00270`	DEAD	11	58	0.42	11.1
TkA02G379150	`PF20720`	nSTAND3	13	45	0.0075	16.7
TkA02G379150	`PF06745`	ATPase	13	51	0.0079	16.3
TkA02G379150	`PF03796`	DnaB_C	13	51	0.039	14.1
TkA02G379150	`PF13555`	AAA_29	13	33	0.18	12.3
TkA02G379150	`PF13191`	AAA_16	14	37	0.017	16.4
TkA02G379150	`PF24883`	NPHP3_N	14	56	0.27	12.1
TkA02G379150	`PF01637`	ATPase_2	16	57	0.11	13.0
TkA02G379150	`PF25199`	nSTAND_NTPase5	16	57	0.14	12.7
TkA02G379150	`PF04851`	ResIII	16	60	0.17	12.5
TkA02G379150	`PF00004`	AAA	19	118	0.047	14.9
TkA02G379150	`PF24883`	NPHP3_N	89	117	0.27	12.1
TkA02G379150	`PF25199`	nSTAND_NTPase5	100	117	0.14	12.7
TkA02G379150	`PF13191`	AAA_16	253	262	0.017	16.4
TkA02G379150	`PF13555`	AAA_29	254	259	0.18	12.3
TkA02G379150	`PF04851`	ResIII	255	265	0.17	12.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card