TkA02G338190 | RubberDandelionOmics

Gene overview

TkA02G338190

Reference: TK1151 Chr: Chr02 Coordinates: 85844903-85846568 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1178 bp · TkA02G338190|TK1151|cDNA

ATCACTTAAAAGATTAGAGGCAAGTGGATATAGCTTTACCGACTAGCTGAGAGAAAAAGAATCGACGGAATTTACGAGGATGGCGAGTAGGCGAGAGCAAAGATGGTCTCTCAAGGGCATGACTGCTCTCGTCACCGGTGGCACCAGAGGAATAGGATATTCAATAGTGGAGGAATTAGCAGGTTTCGGTGCTTCTATACATACGTGTTCTAGAAATCAAAAAGAGATTGATGAAAGGTTGGAAGAATGGAAAGGCAAAG...

CDS

Download CDS FASTA

858 bp · TkA02G338190|TK1151|CDS

ATGGCGAGTAGGCGAGAGCAAAGATGGTCTCTCAAGGGCATGACTGCTCTCGTCACCGGTGGCACCAGAGGAATAGGATATTCAATAGTGGAGGAATTAGCAGGTTTCGGTGCTTCTATACATACGTGTTCTAGAAATCAAAAAGAGATTGATGAAAGGTTGGAAGAATGGAAAGGCAAAGGGTATAATGTTACGGCTTCCGTCTGTGATTTGTTATCTAAAGAACAACGGGTGGAGCTCATAAACACCGTCTCTTCCAT...

Protein

Download Protein FASTA

285 aa · TkA02G338190|TK1151|PROTEIN

MASRREQRWSLKGMTALVTGGTRGIGYSIVEELAGFGASIHTCSRNQKEIDERLEEWKGKGYNVTASVCDLLSKEQRVELINTVSSIFDAKLNILINNAAISRLRDATEYTSEDCAFIMGTNFESPYHLSQLAHPLLKSSGDASIVFISSVAGVTGLPAISVYAASKGAINQLTKNLACEWAKDNIRTNAVAPWGVRTTIMNHEKVDDKIVEAYGPLMARTPLRPIAEPDEISPLVAFLCLPVASYITGQVIVVDAGYTA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G338190`
TK1151 ID	TkA02G338190
OH-1004 ID	LXL04_015396
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	82.800
Protein coverage (%)	TK1151 71.228 / OH-1004 86.383 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G338190

Location Chr02:85844903-85846568 (-)

Description Similar to Tropinone reductase homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g06060`	Tropinone reductase homolog At5g06060.	No verified direct reference in this release
`At2g29350`	Unspecific reductase providing both diastereomeric alcohols from the prochiral ketones.	No verified direct reference in this release
`At2g29150`	Enantiospecific reductase active on cyclic monoterpenes and small flexible lipophilic carbonyls.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015396 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009710 tropane alkaloid biosynthetic process Biological Process

GO:0005777 peroxisome Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016491 oxidoreductase activity Molecular Function

GO:0016616 oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor Molecular Function

GO:0050356 tropine dehydrogenase activity Molecular Function

KEGG gene cross-reference

ag:AAA33281

ath:AT2G29150

ath:AT5G06060

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.474

Rank 1 · TkA02G338190 · TK1151

Peroxisome0.359

Rank 2 · TkA02G338190 · TK1151

Nucleus0.158

Rank 3 · TkA02G338190 · TK1151

Mitochondrion0.128

Rank 4 · TkA02G338190 · TK1151

Plastid0.067

Rank 5 · TkA02G338190 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23441SDR13-209 aa

PF00106adh_short15-205 aa

PF08659KR15-175 aa

PF05368NmrA15-88 aa

PF01370Epimerase16-178 aa

PF13561adh_short_C223-259 aa

PF05368NmrA201-263 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G338190	`PF23441`	SDR	13	209	3.4e-05	24.1
TkA02G338190	`PF00106`	adh_short	15	205	1.2e-46	159.4
TkA02G338190	`PF08659`	KR	15	175	1.1e-13	52.2
TkA02G338190	`PF05368`	NmrA	15	88	0.26	11.5
TkA02G338190	`PF01370`	Epimerase	16	178	0.0014	18.8
TkA02G338190	`PF13561`	adh_short_C2	23	259	2.1e-50	172.2
TkA02G338190	`PF05368`	NmrA	201	263	0.26	11.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LHT0`	Arabidopsis thaliana	sp\|Q9LHT0\|TRNHF_ARATH Tropinone reductase homolog At5g06060	58.700%	Swiss-Prot	High
`Q9ZW18`	Arabidopsis thaliana	sp\|Q9ZW18\|SAG13_ARATH Senescence-associated protein 13	57.600%	Swiss-Prot	High
`Q9ZW03`	Arabidopsis thaliana	sp\|Q9ZW03\|TRNH3_ARATH Tropinone reductase homolog At2g29150	55.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card