RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA02G075040
Reference: TK1151 Chr: Chr02 Coordinates: 19468689-19470786 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1881 bp · TkA02G075040|TK1151|cDNA

ATGGGTTTTTCAAAGTTCTACATGGTACTTTTTCTTGCTTCACTTATGGCACACAATTACATTGCCATTTCCCTAAAAATCAATGCAGATATTGTCATAGGTTTTACAGAAGACGAAAGAAACGCTCTTTTGGCACTCAAAGCTGGATTTCGCAGCACTTTTCTTGATGAAAAGTGGCAAAGCTTCGATTGTCTTGACTGGTATGGTGTCAATTGCAGTGATAATAGAGTCGTTGGTGTAACCCTAGAGAATCTTGACAT...

CDS

Download CDS FASTA

1881 bp · TkA02G075040|TK1151|CDS

ATGGGTTTTTCAAAGTTCTACATGGTACTTTTTCTTGCTTCACTTATGGCACACAATTACATTGCCATTTCCCTAAAAATCAATGCAGATATTGTCATAGGTTTTACAGAAGACGAAAGAAACGCTCTTTTGGCACTCAAAGCTGGATTTCGCAGCACTTTTCTTGATGAAAAGTGGCAAAGCTTCGATTGTCTTGACTGGTATGGTGTCAATTGCAGTGATAATAGAGTCGTTGGTGTAACCCTAGAGAATCTTGACAT...

Protein

Download Protein FASTA

626 aa · TkA02G075040|TK1151|PROTEIN

MGFSKFYMVLFLASLMAHNYIAISLKINADIVIGFTEDERNALLALKAGFRSTFLDEKWQSFDCLDWYGVNCSDNRVVGVTLENLDIYGEVNLDAFYNLTSLSVLSFKNNSLFGQLMDFSRNVDLMQLDLSSNRFNGVISPSLVNLVLLQSLKLQDNNLSGSIPWFDQSSLKELNLSNNNLSGPIPDTKKLQSFNESCYDHNSFLCGPPSSTSCSDTAPPGGDNSGKPEKSGIGVILIIVNILGLFVLLFLLLLLYKNNK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA02G075040
TK1151 IDTkA02G075040
OH-1004 IDLXL04_017099
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)100.000
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA02G075040
LocationChr02:19468689-19470786 (+)
DescriptionSimilar to At5g58300: Probable inactive receptor kinase At5g58300
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g20190 Receptor-like kinase involved in the control of pollen germination and pollen tube polar growth. No verified direct reference in this release
At2g26730 Probable inactive receptor kinase At2g26730. No verified direct reference in this release
At1g50610 Receptor-like kinase involved in the control of pollen germination and pollen tube polar growth.
GRIM REAPER peptide binds to receptor kinase PRK5 to trigger cell death in Arabidopsis.2015 · DOI: 10.15252/embj.201488582
At2g07040 Receptor-like kinase involved in the control of pollen germination and pollen tube polar growth.
A distinct mechanism regulating a pollen-specific guanine nucleotide exchange factor for the small GTPase Rop in Arabidopsis thaliana.2007 · DOI: 10.1073/pnas.0705874104
AtPRK2 promotes ROP1 activation via RopGEFs in the control of polarized pollen tube growth.2013 · DOI: 10.1093/mp/sss103
The juxtamembrane and carboxy-terminal domains of Arabidopsis PRK2 are critical for ROP-induced growth in pollen tubes.2013 · DOI: 10.1093/jxb/ert323
At5g35390 Receptor-like kinase involved in the control of pollen germination and pollen tube polar growth.
AtPRK2 promotes ROP1 activation via RopGEFs in the control of polarized pollen tube growth.2013 · DOI: 10.1093/mp/sss103

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_017099 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0080092 regulation of pollen tube growth Biological Process
GO:0005576 extracellular region Cellular Component
GO:0005777 peroxisome Cellular Component
GO:0005829 cytosol Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0009505 plant-type cell wall Cellular Component
GO:0009506 plasmodesma Cellular Component
GO:0009898 cytoplasmic side of plasma membrane Cellular Component
GO:0016328 lateral plasma membrane Cellular Component
GO:0004672 protein kinase activity Molecular Function
GO:0004674 protein serine/threonine kinase activity Molecular Function
GO:0005524 ATP binding Molecular Function
KEGG gene cross-reference
ath:AT1G68400
ath:AT2G26730
ath:AT3G08680
ath:AT4G31250
ath:AT5G58300
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.871
Rank 1 · TkA02G075040 · TK1151
Endoplasmic reticulum0.093
Rank 2 · TkA02G075040 · TK1151
Cytoplasm0.067
Rank 3 · TkA02G075040 · TK1151
Nucleus0.049
Rank 4 · TkA02G075040 · TK1151
Lysosome / Vacuole0.024
Rank 5 · TkA02G075040 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263LRRNT_237-73 aa
PF00560LRR_171-84 aa
PF12799LRR_482-110 aa
PF13855LRR_891-112 aa
PF00560LRR_1101-117 aa
PF13855LRR_8119-159 aa
PF13516LRR_6124-136 aa
PF00560LRR_1125-146 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA02G075040PF08263LRRNT_237730.02115.8
TkA02G075040PF00560LRR_171848.8e-0728.6
TkA02G075040PF12799LRR_4821100.001519.4
TkA02G075040PF13855LRR_8911125.7e-0729.9
TkA02G075040PF00560LRR_11011178.8e-0728.6
TkA02G075040PF13855LRR_81191595.7e-0729.9
TkA02G075040PF13516LRR_61241360.0414.7
TkA02G075040PF00560LRR_11251468.8e-0728.6
TkA02G075040PF12799LRR_41281650.001519.4
TkA02G075040PF00560LRR_11491658.8e-0728.6
TkA02G075040PF12799LRR_41491850.001519.4
TkA02G075040PF13516LRR_61491610.0414.7
TkA02G075040PF13855LRR_81661835.7e-0729.9
TkA02G075040PF13516LRR_61691830.0414.7
TkA02G075040PF00560LRR_11701878.8e-0728.6
TkA02G075040PF12799LRR_41701950.001519.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9LJY0Arabidopsis thalianasp|Q9LJY0|PRK4_ARATH Pollen receptor-like kinase 431.900%Swiss-ProtMedium
O48788Arabidopsis thalianasp|O48788|Y2267_ARATH Probable inactive receptor kinase At2g2673043.700%Swiss-ProtMedium
Q9LPT1Arabidopsis thalianasp|Q9LPT1|PRK5_ARATH Pollen receptor-like kinase 530.400%Swiss-ProtMedium
Q84JQ4Arabidopsis thalianasp|Q84JQ4|PRK2_ARATH Pollen receptor-like kinase 232.100%Swiss-ProtMedium
C0LGU0Arabidopsis thalianasp|C0LGU0|PRK1_ARATH Pollen receptor-like kinase 132.000%Swiss-ProtMedium

JBrowse

View in Genome Browser