RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA02G063220
Reference: TK1151 Chr: Chr02 Coordinates: 16467508-16475172 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2884 bp · TkA02G063220|TK1151|cDNA

TACATACGTTAAATAAATTTGGCTAGTCTTGGCTTGACTTTTCAGCTGTCAAGATAAAAAGAAGTCATCCCTTGAGCAAACCCAAGAACAATTCATCTCAATAACAAAACTTTCCCTATTTTGACAATCTTCTCTACCAGATGGTTTAGTTTAGCAACCAGGGTAGTTTTCCTCACTCATCTTCTTATAATTCTCAAGAATAAAAATCCCGCATTTTTTTCTAGTCATGGCGTTTTCCGGCAGCCATGTGTTTATCCACT...

CDS

Download CDS FASTA

1506 bp · TkA02G063220|TK1151|CDS

ATGCGTAGTGGGCAAATCTGTGAATCTTGGATTACATATGACTCTGTTTCACAGAATCTTAGTGTTTCCTTTACTGGTTTTCAAAATAATGTAACTATAATTCAAGCACTTCATTACACAATCGACCTGAGGACTGTGTTGCCGGAATGGGTTATTTTCGGGTTTTCAGCAGCAACCGGATCTTCATTCGAGAAAAATAACGTGATATCTTGGAGTTTCAGTAGTTCTGATTTACAGGTTGATAAAGACAACGGGCTACC...

Protein

Download Protein FASTA

501 aa · TkA02G063220|TK1151|PROTEIN

MRSGQICESWITYDSVSQNLSVSFTGFQNNVTIIQALHYTIDLRTVLPEWVIFGFSAATGSSFEKNNVISWSFSSSDLQVDKDNGLPQNPGNNNSKIGLAVGLSIGVTFLAVAVFVFALWRRKTKNKEDEEEDEDDDNEALGFGMEMNSEFEMGTGPKRFSYKELARSTSEFSENEKLGEGGFGGVYRGFLKDSNTYVAVKRVSKSSKQGTKEYAAEVKIISRLRHRNLVQLIGWCHDKKELLLVYEFMENGSLDSHIFK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA02G063220
TK1151 IDTkA02G063220
OH-1004 IDLXL04_017253
Relationship / confidenceRbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)87.000
Protein coverage (%)TK1151 99.401 / OH-1004 71.787
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA02G063220
LocationChr02:16467508-16475172 (+)
DescriptionSimilar to LECRK91: L-type lectin-domain containing receptor kinase IX.1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g10530 Promotes hydrogen peroxide H(2)O(2) production and cell death. No verified direct reference in this release
At5g65600 Promotes hydrogen peroxide H(2)O(2) production and cell death. No verified direct reference in this release
At3g55550 Involved in resistance response to the pathogenic oomycetes Phytophthora infestans and Phytophthora capsici and to the pathogenic bacteria Pseudomonas syringae. No verified direct reference in this release
At3g53380 L-type lectin-domain containing receptor kinase VIII.1. No verified direct reference in this release
At5g55830 Involved in resistance response to the pathogenic oomycetes Phytophthora infestans and Phytophthora capsici. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os04g0531400 Lectin-domain containing receptor kinase involved in salt stress response. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_017253 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0002229 defense response to oomycetes Biological Process
GO:0006468 protein phosphorylation Biological Process
GO:0009555 pollen development Biological Process
GO:0009626 plant-type hypersensitive response Biological Process
GO:0009862 systemic acquired resistance, salicylic acid mediated signaling pathway Biological Process
GO:0042742 defense response to bacterium Biological Process
GO:0140426 pathogen-associated molecular pattern receptor signaling pathway Biological Process
GO:1900426 positive regulation of defense response to bacterium Biological Process
GO:0005576 extracellular region Cellular Component
GO:0005829 cytosol Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0009507 chloroplast Cellular Component
KEGG gene cross-reference
ath:AT3G53810
ath:AT4G02410
ath:AT5G10530
ath:AT5G55830
ath:AT5G65600
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.820
Rank 1 · TkA02G063220 · TK1151
Cytoplasm0.095
Rank 2 · TkA02G063220 · TK1151
Endoplasmic reticulum0.083
Rank 3 · TkA02G063220 · TK1151
Nucleus0.061
Rank 4 · TkA02G063220 · TK1151
Lysosome / Vacuole0.031
Rank 5 · TkA02G063220 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00139Lectin_legB2-82 aa
PF18483Lectin_L-type_dom8-68 aa
PF14610Psg185-125 aa
PF08693SKG693-155 aa
PF29481SKG196-176 aa
PF15029TMEM174101-140 aa
PF14575EphA2_TM102-139 aa
PF00069Pkinase173-439 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA02G063220PF00139Lectin_legB2821.4e-1971.4
TkA02G063220PF18483Lectin_L-type_dom8680.06313.8
TkA02G063220PF14610Psg1851250.002818.2
TkA02G063220PF08693SKG6931550.0008919.0
TkA02G063220PF29481SKG1961760.01116.4
TkA02G063220PF15029TMEM1741011400.1412.5
TkA02G063220PF14575EphA2_TM1021390.2312.9
TkA02G063220PF00069Pkinase1734391.5e-52179.3
TkA02G063220PF07714PK_Tyr_Ser-Thr1753792.7e-48165.3
TkA02G063220PF03109ABC11752090.0007419.5
TkA02G063220PF17667Pkinase_fungal2062435.4e-0522.8
TkA02G063220PF01636APH2062500.09913.1
TkA02G063220PF03109ABC12433250.0007419.5
TkA02G063220PF01636APH2833080.09913.1
TkA02G063220PF17667Pkinase_fungal2903585.4e-0522.8
TkA02G063220PF29481SKG14664970.01116.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9LXA5Arabidopsis thalianasp|Q9LXA5|LRK91_ARATH L-type lectin-domain containing receptor kinase IX.150.300%Swiss-ProtHigh
Q9LSL5Arabidopsis thalianasp|Q9LSL5|LRK92_ARATH L-type lectin-domain containing receptor kinase IX.249.800%Swiss-ProtMedium
Q9M2S4Arabidopsis thalianasp|Q9M2S4|LRKS4_ARATH L-type lectin-domain containing receptor kinase S.440.400%Swiss-ProtMedium
Q9LFH9Arabidopsis thalianasp|Q9LFH9|LRK81_ARATH L-type lectin-domain containing receptor kinase VIII.139.400%Swiss-ProtMedium
Q9FHG4Arabidopsis thalianasp|Q9FHG4|LRKS7_ARATH Probable L-type lectin-domain containing receptor kinase S.750.600%Swiss-ProtHigh
Q7XUN6Oryza sativa subsp. japonicasp|Q7XUN6|SIT2_ORYSJ L-type lectin-domain containing receptor kinase SIT241.000%Swiss-ProtMedium

JBrowse

View in Genome Browser