TkA01G630770 | RubberDandelionOmics

Gene overview

TkA01G630770

Reference: TK1151 Chr: Chr01 Coordinates: 159504051-159506744 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1527 bp · TkA01G630770|TK1151|cDNA

ATGGAGCAACTTGGTGGTGTTCAATATTGCGTTAATAGTCCACCGCCATGGAAAGAAGCGGTGTTATTAGGGTTCCAACATTATGTTTTATCACTTGGTAACACTGTGTTGATTTCAACGATGACGGTTTCTCAAATGGGCGGTGATAATGGTGAGAAAGCCAGGGTGATTCAGACGCTGCTTTTTCTTTCGGGGATTAACACATTAACGCAAACCATGTTTGGAACTCGATTGCCATCGGTTGTTGGTGGATCACATGC...

CDS

Download CDS FASTA

1527 bp · TkA01G630770|TK1151|CDS

ATGGAGCAACTTGGTGGTGTTCAATATTGCGTTAATAGTCCACCGCCATGGAAAGAAGCGGTGTTATTAGGGTTCCAACATTATGTTTTATCACTTGGTAACACTGTGTTGATTTCAACGATGACGGTTTCTCAAATGGGCGGTGATAATGGTGAGAAAGCCAGGGTGATTCAGACGCTGCTTTTTCTTTCGGGGATTAACACATTAACGCAAACCATGTTTGGAACTCGATTGCCATCGGTTGTTGGTGGATCACATGC...

Protein

Download Protein FASTA

508 aa · TkA01G630770|TK1151|PROTEIN

MEQLGGVQYCVNSPPPWKEAVLLGFQHYVLSLGNTVLISTMTVSQMGGDNGEKARVIQTLLFLSGINTLTQTMFGTRLPSVVGGSHAFLVPVISIVHAKRYHMYQEPHQRFAQTMRGIQGALVVASAFQMLLGFLGLWRNIVKYLSPLSVVPLVTFTGLGLYHLAFPMLEKCVAIGLAELALIVIISQYLPPYITSKRPICDRFVILFSVSIAWTCAVILTWSGAYTKSTTNTLNTCRTNHSGLINGSPWIYVPYPFQWG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G630770`
TK1151 ID	TkA01G630770
OH-1004 ID	LXL04_000158
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.800
Protein coverage (%)	TK1151 100.000 / OH-1004 95.420 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G630770

Location Chr01:159504051-159506744 (+)

Description Similar to NAT10: Putative nucleobase-ascorbate transporter 10

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g65550`	Putative nucleobase-ascorbate transporter 10.	No verified direct reference in this release
`At1g60030`	Nucleobase-ascorbate transporter 7.	No verified direct reference in this release
`At1g49960`	Nucleobase-ascorbate transporter 4.	No verified direct reference in this release
`At5g62890`	Nucleobase-ascorbate transporter 6.	No verified direct reference in this release
`At5g49990`	Nucleobase-ascorbate transporter 5.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000158 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0016020 membrane Cellular Component

GO:0022857 transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G10540

ath:AT1G49960

ath:AT1G60030

ath:AT1G65550

ath:AT5G62890

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.821

Rank 1 · TkA01G630770 · TK1151

Cytoplasm0.114

Rank 2 · TkA01G630770 · TK1151

Lysosome / Vacuole0.059

Rank 3 · TkA01G630770 · TK1151

Endoplasmic reticulum0.056

Rank 4 · TkA01G630770 · TK1151

Mitochondrion0.037

Rank 5 · TkA01G630770 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00860Xan_ur_permease19-423 aa

PF16983MFS_MOT135-160 aa

PF19063DUF575977-102 aa

PF26496DUF8163114-218 aa

PF19063DUF5759253-277 aa

PF26496DUF8163347-368 aa

PF16983MFS_MOT1349-379 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G630770	`PF00860`	Xan_ur_permease	19	423	5.7e-59	200.5
TkA01G630770	`PF16983`	MFS_MOT1	35	160	4.9	8.3
TkA01G630770	`PF19063`	DUF5759	77	102	0.18	12.5
TkA01G630770	`PF26496`	DUF8163	114	218	0.99	10.1
TkA01G630770	`PF19063`	DUF5759	253	277	0.18	12.5
TkA01G630770	`PF26496`	DUF8163	347	368	0.99	10.1
TkA01G630770	`PF16983`	MFS_MOT1	349	379	4.9	8.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04472`	Arabidopsis thaliana	sp\|O04472\|NAT10_ARATH Putative nucleobase-ascorbate transporter 10	55.900%	Swiss-Prot	High
`Q0WPE9`	Arabidopsis thaliana	sp\|Q0WPE9\|NAT7_ARATH Nucleobase-ascorbate transporter 7	55.300%	Swiss-Prot	High
`P93039`	Arabidopsis thaliana	sp\|P93039\|NAT4_ARATH Nucleobase-ascorbate transporter 4	54.000%	Swiss-Prot	High
`Q27GI3`	Arabidopsis thaliana	sp\|Q27GI3\|NAT6_ARATH Nucleobase-ascorbate transporter 6	55.200%	Swiss-Prot	High
`Q8RWE9`	Arabidopsis thaliana	sp\|Q8RWE9\|NAT5_ARATH Nucleobase-ascorbate transporter 5	54.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card