RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G617350
Reference: TK1151 Chr: Chr01 Coordinates: 155755560-155759149 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2304 bp · TkA01G617350|TK1151|cDNA

CAAAAACGCAAGATAGACATTTGTAGAGATCAGTTTTTTCCAGAAGAGAAGAGACAAAGAGAGAAGTAGATAAAAACTGCCACATGACAAGTGCAAACACACACACAACTCAGAAAAAGTTTGTAATCAGATTTCTTGAAGAACAGAATCGAGCAAAGTGTACTTCAAATTAAAAACGAAAGAGAGACAGCAAAAATCAACTTTGGGAGCAGCTGCGGCGGCGGCGGAGCTCAGGGAATGGGTATATTCTTGGTTTTCTA...

CDS

Download CDS FASTA

1377 bp · TkA01G617350|TK1151|CDS

ATGGGTATATTCTTGGTTTTCTACCCTGAAGAACAGCAATTCAATTCTTCAACACCTTCATCAACATCTTCATTATCGCCATTTAAATCTCCCAAAATTAACGCGTTTCTCAAACGCACCAATTCCAGTCATATTTTCACCAGAGCTCAATCCACCATCTCCATTTGTGCTCTGCTCATCTTCCTCACTTTCCTCCTCTTCACTCTCTCATCCTTCGAGCCCAACAATGATTTCATCACCTCTCATAATCTTCATCATTA...

Protein

Download Protein FASTA

458 aa · TkA01G617350|TK1151|PROTEIN

MGIFLVFYPEEQQFNSSTPSSTSSLSPFKSPKINAFLKRTNSSHIFTRAQSTISICALLIFLTFLLFTLSSFEPNNDFITSHNLHHYRRFLSQNHPKFHPKPRWNPPALQGLGTLYTRGTMAMNELVICHVSESVTKKELKLFLRGFHRSGLASKSDLLFVFNSISTIDSFNDLIMEENDLFLKLVHRYKSELGNGSKAIDFPASFDVTRFVKSGKEADKGEPIWDRKIKSSNSSFSNGENRTESTRMSYGSVVGFGISE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G617350
TK1151 IDTkA01G617350
OH-1004 IDLXL04_000365
Relationship / confidenceRbh Sequence Supported / Probable
Protein identity (%)99.500
Protein coverage (%)TK1151 94.323 / OH-1004 71.880
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G617350
LocationChr01:155755560-155759149 (-)
DescriptionSimilar to CSLD5: Cellulose synthase-like protein D5
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_000365 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0000919 cell plate assembly Biological Process
GO:0006970 response to osmotic stress Biological Process
GO:0009409 response to cold Biological Process
GO:0009414 response to water deprivation Biological Process
GO:0009625 response to insect Biological Process
GO:0009651 response to salt stress Biological Process
GO:0009833 plant-type primary cell wall biogenesis Biological Process
GO:0030244 cellulose biosynthetic process Biological Process
GO:0042546 cell wall biogenesis Biological Process
GO:0048367 shoot system development Biological Process
GO:0048767 root hair elongation Biological Process
GO:0071555 cell wall organization Biological Process
KEGG gene cross-reference
ath:AT1G02730
ath:AT3G03050
ath:AT5G16910
dosa:Os06g0111800
dosa:Os12g0555600
osa:4339895
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.535
Rank 1 · TkA01G617350 · TK1151
Endoplasmic reticulum0.135
Rank 2 · TkA01G617350 · TK1151
Cell membrane0.117
Rank 3 · TkA01G617350 · TK1151
Extracellular0.083
Rank 4 · TkA01G617350 · TK1151
Nucleus0.082
Rank 5 · TkA01G617350 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25002DUF7780107-410 aa
PF25043DUF7788126-138 aa
PF25043DUF7788372-455 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA01G617350PF25002DUF77801074101.6e-133445.4
TkA01G617350PF25043DUF77881261380.09412.7
TkA01G617350PF25043DUF77883724550.09412.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser