TkA01G588280 | RubberDandelionOmics

Gene overview

TkA01G588280

Reference: TK1151 Chr: Chr01 Coordinates: 147985144-147987109 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1087 bp · TkA01G588280|TK1151|cDNA

GGGGGGGACGCACGAGGTCACACAATTCCACAGTTCCACTCGTTTCTCTTCTAACCTACGTCTTCTCCTCTCTAACTCAAAACCCTAAATCGACAATCAGAGAGGCGCCGCGATAACCGAGCAAGAGCTTCTCACAGCCGTTACCTGCTTCTCACAGCCCTTGTTTCCACTCGTTACCTGCTTCGCCATCCACAGTCGCGAGTTCCACGTCTACCTGTATCTTCACAGCCGCGAGTTGGAGCAAGTCGTCATCCACAGTC...

CDS

Download CDS FASTA

468 bp · TkA01G588280|TK1151|CDS

ATGGCGATGCAAACCTCTCACACCCAAGCACTGAAAGATATCGTACCAGCAGCAAGAAACAACATCAACACACAATTCATAGTTTTGGAAAAAGGAAGAATAACAACAGAAGGAGGTCAAAACAAGACATGTATGGGATTAGTTGCAGATGAAACTGCGTCTGTTCACTTTCAATTATGGAATGAAGAGTGTGATTCATTTCAACCAGGAGACATTATTCATTTGTCAAATGGGATATTTTCTTATCATCATGGCAGTAA...

Protein

Download Protein FASTA

155 aa · TkA01G588280|TK1151|PROTEIN

MAMQTSHTQALKDIVPAARNNINTQFIVLEKGRITTEGGQNKTCMGLVADETASVHFQLWNEECDSFQPGDIIHLSNGIFSYHHGSNLVLRAGKRGKVEKVGEFTMAFVESPNMSEILWLPDPNNSGKYVRESVISPFSRIFQCCKKRPRCFKLP

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G588280`
TK1151 ID	TkA01G588280
OH-1004 ID	LXL04_000786
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G588280`
Location	Chr01:147985144-147987109 (-)
Description	Similar to DDB_G0279223: SOSS complex subunit B homolog
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_000786` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000724 double-strand break repair via homologous recombination Biological Process GO:0006281 DNA repair Biological Process GO:0006974 DNA damage response Biological Process GO:0010212 response to ionizing radiation Biological Process GO:0044818 mitotic G2/M transition checkpoint Biological Process GO:0070200 establishment of protein localization to telomere Biological Process GO:1904355 positive regulation of telomere capping Biological Process GO:0000781 chromosome, telomeric region Cellular Component GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005694 chromosome Cellular Component GO:0005829 cytosol Cellular Component
KEGG gene cross-reference	bta:533842 ddi:DDB_G0279223 hsa:79035 mmu:69917 xla:446552 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.713

Rank 1 · TkA01G588280 · TK1151

Cytoplasm0.317

Rank 2 · TkA01G588280 · TK1151

Cell membrane0.061

Rank 3 · TkA01G588280 · TK1151

Mitochondrion0.057

Rank 4 · TkA01G588280 · TK1151

Endoplasmic reticulum0.041

Rank 5 · TkA01G588280 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01336tRNA_anti-codon31-85 aa

PF21473OB_Ssb-like39-99 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G588280	`PF01336`	tRNA_anti-codon	31	85	0.063	13.9
TkA01G588280	`PF21473`	OB_Ssb-like	39	99	6e-05	23.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card