TkA01G578880 | RubberDandelionOmics

Gene overview

TkA01G578880

Reference: TK1151 Chr: Chr01 Coordinates: 145587366-145596925 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5490 bp · TkA01G578880|TK1151|cDNA

TGAAAATTAGAATTTAGAGCAATTCCGAACGACGTGGGAGGGAACCCCAGCTAAGCTAACGAAGAGAAAGACTAAAGAAAAGAAAAGAAACAGTCGCCATTCATCAACAAAATACGAAAGCTTAGGGATTCCATTTTCCTTAAAAATCTCAAGAATCCGACTTCCAAATTTGGCAGAGGCTCATCAATCAACTCGATCTCTGCTCTGCTGCCTGATCTTTCACTGTTCTTTTTTCGATTTATACGAACACCGTTTACTGT...

CDS

Download CDS FASTA

4509 bp · TkA01G578880|TK1151|CDS

ATGGCTGCAGTCAGTGTAGGTGTTGGATCACTTGTTTGGGTGGAGGATCCAGATGATGCTTGGATAGATGGGGAAGTTATTGAGGTTAATGGTGAAGACATCAAGATTGCTTCTACTTCAGGAAAGACGGTTGTTGCCAAGTCATCAAATGTATACCCCAAAGATGCTGAAGCACCACCATGTGGAGTGGATGACATGACAAAACTCGCTTATTTGCATGAACCAGGGGTTCTTAATAACCTAAGATCTAGATACGATAT...

Protein

Download Protein FASTA

1502 aa · TkA01G578880|TK1151|PROTEIN

MAAVSVGVGSLVWVEDPDDAWIDGEVIEVNGEDIKIASTSGKTVVAKSSNVYPKDAEAPPCGVDDMTKLAYLHEPGVLNNLRSRYDINEIYTYTGSILIAVNPFTRLPHLYDTHMMAQYKGAAFGELSPHPFAVADAAYRVMIHEGISQSILVSGESGAGKTESTKQLMRYLAYMGGRASTDGRSVEQKVLESNPVLEAFGNAKTVRNNNSSRFGKFVEIQFDEKGRISGAAIRTYLLERSRVCQLSDPERNYHCFYMLC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G578880`
TK1151 ID	TkA01G578880
OH-1004 ID	LXL04_014595
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	66.900
Protein coverage (%)	TK1151 99.867 / OH-1004 99.799 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G578880

Location Chr01:145587366-145596925 (+)

Description Similar to XI-2: Myosin-6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g43900`	Myosin heavy chain that is required for the cell cycle- regulated transport of various organelles and proteins for their segregation.	Peroxisomal localization of a myosin XI isoform in Arabidopsis thaliana.2005 · DOI: 10.1093/pcp/pci085 Two class XI myosins function in organelle trafficking and root hair development in Arabidopsis.2008 · DOI: 10.1104/pp.107.113654 A comparative study of the involvement of 17 Arabidopsis myosin family members on the motility of Golgi and other organelles.2009 · DOI: 10.1104/pp.109.136853 Myosin XIK is a major player in cytoplasm dynamics and is regulated by two amino acids in its tail.2012 · DOI: 10.1093/jxb/err265
`At1g04160`	Myosin heavy chain that is required for the cell cycle-regulated transport of various organelles and proteins for their segregation.	No verified direct reference in this release
`At4g28710`	Myosin heavy chain that is required for the cell cycle-regulated transport of various organelles and proteins for their segregation.	No verified direct reference in this release
`At2g20290`	Myosin heavy chain that is required for the cell cycle-regulated transport of various organelles and proteins for their segregation.	No verified direct reference in this release
`At5g20490`	Myosin heavy chain that is required for the cell cycle-regulated transport of various organelles and proteins for their segregation.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014595 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007015 actin filament organization Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0010090 trichome morphogenesis Biological Process

GO:0030048 actin filament-based movement Biological Process

GO:0048467 gynoecium development Biological Process

GO:0048767 root hair elongation Biological Process

GO:0051645 Golgi localization Biological Process

GO:0051646 mitochondrion localization Biological Process

GO:0060151 peroxisome localization Biological Process

GO:0090436 leaf pavement cell development Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT1G04160

ath:AT1G08730

ath:AT1G54560

ath:AT4G28710

ath:AT5G43900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.571

Rank 1 · TkA01G578880 · TK1151

Cell membrane0.269

Rank 2 · TkA01G578880 · TK1151

Golgi apparatus0.164

Rank 3 · TkA01G578880 · TK1151

Nucleus0.159

Rank 4 · TkA01G578880 · TK1151

Lysosome / Vacuole0.079

Rank 5 · TkA01G578880 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02736Myosin_N9-54 aa

PF00063Myosin_head63-719 aa

PF13401AAA_2263-89 aa

PF13191AAA_16136-186 aa

PF13401AAA_22149-172 aa

PF13245AAA_19149-178 aa

PF07475Hpr_kinase_C150-169 aa

PF00005ABC_tran150-191 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G578880	`PF02736`	Myosin_N	9	54	1.9e-08	34.6
TkA01G578880	`PF00063`	Myosin_head	63	719	8.8e-258	857.8
TkA01G578880	`PF13401`	AAA_22	63	89	0.041	14.9
TkA01G578880	`PF13191`	AAA_16	136	186	0.0019	19.5
TkA01G578880	`PF13401`	AAA_22	149	172	0.041	14.9
TkA01G578880	`PF13245`	AAA_19	149	178	0.55	11.1
TkA01G578880	`PF07475`	Hpr_kinase_C	150	169	0.18	12.1
TkA01G578880	`PF00005`	ABC_tran	150	191	0.84	11.0
TkA01G578880	`PF13238`	AAA_18	151	202	0.2	12.9
TkA01G578880	`PF07475`	Hpr_kinase_C	428	496	0.18	12.1
TkA01G578880	`PF28002`	YfjT_2	459	478	0.21	12.2
TkA01G578880	`PF13191`	AAA_16	602	622	0.0019	19.5
TkA01G578880	`PF28002`	YfjT_2	609	625	0.21	12.2
TkA01G578880	`PF00612`	IQ	736	754	3.7e-25	86.0
TkA01G578880	`PF00612`	IQ	758	777	3.7e-25	86.0
TkA01G578880	`PF00612`	IQ	784	803	3.7e-25	86.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LKB9`	Arabidopsis thaliana	sp\|Q9LKB9\|MYO6_ARATH Myosin-6	76.900%	Swiss-Prot	High
`F4I460`	Arabidopsis thaliana	sp\|F4I460\|MYO8_ARATH Myosin-8	76.000%	Swiss-Prot	High
`F4JM19`	Arabidopsis thaliana	sp\|F4JM19\|MYO14_ARATH Myosin-14	73.400%	Swiss-Prot	High
`F4IUG9`	Arabidopsis thaliana	sp\|F4IUG9\|MYO13_ARATH Myosin-13	66.100%	Swiss-Prot	High
`F4K5J1`	Arabidopsis thaliana	sp\|F4K5J1\|MYO17_ARATH Myosin-17	66.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card