TkA01G521540 | RubberDandelionOmics

Gene overview

TkA01G521540

Reference: TK1151 Chr: Chr01 Coordinates: 130794754-130797388 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA No cDNA sequence available

cDNA

No cDNA sequence is available for this reference.

CDS

Download CDS FASTA

963 bp · TkA01G521540|TK1151|CDS

ATGAAGCTTTTCACAAGTATTTTCTATTTAATCATCCTCCTAGCATCTCTTTTATCGTATTGCTTATTAAAGAAAGAAAAAAGGAAGCAAAAACCAACAGCAAAGCTTCCTCCAGGCTCAATGGGGTGGCCTTTCATCGGTGAAACTCTCCAAATGTACTCACAAGACCCCAACATCTTTTTCGCCTCAAAACAAAAAAGATATGGAGATATATTTAAAACCCGAATACTTGGGTACCCTTGTGTGATGCTAGCAAGCCC...

Protein

Download Protein FASTA

320 aa · TkA01G521540|TK1151|PROTEIN

MKLFTSIFYLIILLASLLSYCLLKKEKRKQKPTAKLPPGSMGWPFIGETLQMYSQDPNIFFASKQKRYGDIFKTRILGYPCVMLASPEAARFVLVTQPQLFKPTYPKSKEKLIGPSALFFHQGDYHARMRKLVQSSFSPEASRKVITDIERIAISSLESWSNGQVINTFLEMKKFAFEVGVLSIFGQLEKKYTEELKENYCILEKGYNCFPTKLPGTAYYKALKARRRLNRIIGEIVQERKEKKMSATNLLGQLLNYKGE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G521540`
TK1151 ID	TkA01G521540
OH-1004 ID	LXL04_001625
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	99.700
Protein coverage (%)	TK1151 96.250 / OH-1004 65.672 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G521540

Location Chr01:130794754-130797388 (-)

Description Similar to CYP707A4: Abscisic acid 8'-hydroxylase 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g19270`	Participates in ABA oxidative degradation but does not catalyze the isomerization of 8′-hydroxy-ABA to (−)-phaseic acid.	The Arabidopsis cytochrome P450 CYP707A encodes ABA 8'-hydroxylases: key enzymes in ABA catabolism.2004 · DOI: 10.1038/sj.emboj.7600121 CYP707A1 and CYP707A2, which encode abscisic acid 8'-hydroxylases, are indispensable for proper control of seed dormancy and germination in Arabidopsis.2006 · DOI: 10.1104/pp.106.079475

Rice

Reference gene ID	Possible function	Papers / DOI
`Os09g0457100`	Involved in the oxidative degradation of abscisic acid.	No verified direct reference in this release
`UniProt: Q09J78`	Involved in the oxidative degradation of abscisic acid.	No verified direct reference in this release
`UniProt: A2Z212`	Involved in the oxidative degradation of abscisic acid.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001625 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009414 response to water deprivation Biological Process

GO:0009733 response to auxin Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009856 pollination Biological Process

GO:0016125 sterol metabolic process Biological Process

GO:0046345 abscisic acid catabolic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0016020 membrane Cellular Component

GO:0005506 iron ion binding Molecular Function

GO:0010295 (+)-abscisic acid 8'-hydroxylase activity Molecular Function

GO:0020037 heme binding Molecular Function

KEGG gene cross-reference

ath:AT3G19270

dosa:Os09g0457100

sly:100136887

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.835

Rank 1 · TkA01G521540 · TK1151

Golgi apparatus0.104

Rank 2 · TkA01G521540 · TK1151

Cytoplasm0.052

Rank 3 · TkA01G521540 · TK1151

Nucleus0.035

Rank 4 · TkA01G521540 · TK1151

Cell membrane0.034

Rank 5 · TkA01G521540 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29364TED64-30 aa

PF00067p45037-304 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G521540	`PF29364`	TED6	4	30	0.23	12.1
TkA01G521540	`PF00067`	p450	37	304	1.2e-26	94.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LJK2`	Arabidopsis thaliana	sp\|Q9LJK2\|ABAH4_ARATH Abscisic acid 8'-hydroxylase 4	68.000%	Swiss-Prot	High
`Q0J185`	Oryza sativa subsp. japonica	sp\|Q0J185\|ABAH3_ORYSJ Abscisic acid 8'-hydroxylase 3	61.400%	Swiss-Prot	High
`Q09J78`	Oryza sativa subsp. indica	sp\|Q09J78\|ABAH2_ORYSI Abscisic acid 8'-hydroxylase 2	60.600%	Swiss-Prot	High
`A2Z212`	Oryza sativa subsp. indica	sp\|A2Z212\|ABAH3_ORYSI Abscisic acid 8'-hydroxylase 3	61.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card