TkA01G511810 | RubberDandelionOmics

Gene overview

TkA01G511810

Reference: TK1151 Chr: Chr01 Coordinates: 128257223-128264446 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

606 bp · TkA01G511810|TK1151|cDNA

ATGTCAAGTTATGTATACGAAGAATTGATTGTTGAAATTTTTACAAGATTACCGTCTAAATCCCTCATCCGATTTAGATCACTCTCAAAATCGTTATATAGTTGTATTTCTAGCCCTGGTTTCATACGATTACACACTTTTCGATCCCCACAAAAAGTACTTTCCATACATTACTACTCAAAAAAGGAAGCCGTATATACATTACATGGAGAAGACTGGTTGTCATTGTCTCCCAAAGATGGATACATTGGTATAACAAC...

CDS

Download CDS FASTA

606 bp · TkA01G511810|TK1151|CDS

ATGTCAAGTTATGTATACGAAGAATTGATTGTTGAAATTTTTACAAGATTACCGTCTAAATCCCTCATCCGATTTAGATCACTCTCAAAATCGTTATATAGTTGTATTTCTAGCCCTGGTTTCATACGATTACACACTTTTCGATCCCCACAAAAAGTACTTTCCATACATTACTACTCAAAAAAGGAAGCCGTATATACATTACATGGAGAAGACTGGTTGTCATTGTCTCCCAAAGATGGATACATTGGTATAACAAC...

Protein

Download Protein FASTA

201 aa · TkA01G511810|TK1151|PROTEIN

MSSYVYEELIVEIFTRLPSKSLIRFRSLSKSLYSCISSPGFIRLHTFRSPQKVLSIHYYSKKEAVYTLHGEDWLSLSPKDGYIGITTMYINFQHSFYRFLGSCNGIFCLESRNSFTLWNPSITSKLTLPCFPRDHKILEPFTSEEFGFGFDPISDDYKIIHISYARDTSLVYAVKTGIWREIASPKPKYKHILMCHIKHVY

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G511810`
TK1151 ID	TkA01G511810
OH-1004 ID	LXL04_039922
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	56.500
Protein coverage (%)	TK1151 92.537 / OH-1004 53.955 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G511810

Location Chr01:128257223-128264446 (+)

Description Similar to At3g16210: Putative F-box protein At3g16210

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g07870`	F-box protein At3g07870.	No verified direct reference in this release
`At4g21240`	Putative F-box protein At4g21240.	No verified direct reference in this release
`At1g47790`	Putative F-box protein At1g47790.	No verified direct reference in this release
`At5g18160`	F-box protein At5g18160.	No verified direct reference in this release
`At4g19940`	F-box protein At4g19940.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039922 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT2G40910

ath:AT3G06240

ath:AT3G16210

ath:AT4G19930

ath:AT4G21240

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.692

Rank 1 · TkA01G511810 · TK1151

Nucleus0.438

Rank 2 · TkA01G511810 · TK1151

Endoplasmic reticulum0.061

Rank 3 · TkA01G511810 · TK1151

Cell membrane0.057

Rank 4 · TkA01G511810 · TK1151

Mitochondrion0.025

Rank 5 · TkA01G511810 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box7-42 aa

PF12937F-box-like7-39 aa

PF03478Beta-prop_KIB1-453-80 aa

PF08268FBA_388-189 aa

PF03478Beta-prop_KIB1-497-196 aa

PF12937F-box-like179-183 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G511810	`PF00646`	F-box	7	42	8.1e-08	32.6
TkA01G511810	`PF12937`	F-box-like	7	39	0.0011	19.4
TkA01G511810	`PF03478`	Beta-prop_KIB1-4	53	80	0.0014	19.0
TkA01G511810	`PF08268`	FBA_3	88	189	2.1e-10	40.8
TkA01G511810	`PF03478`	Beta-prop_KIB1-4	97	196	0.0014	19.0
TkA01G511810	`PF12937`	F-box-like	179	183	0.0011	19.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SFC7`	Arabidopsis thaliana	sp\|Q9SFC7\|FB135_ARATH F-box protein At3g07870	30.000%	Swiss-Prot	Medium
`O49565`	Arabidopsis thaliana	sp\|O49565\|FB239_ARATH Putative F-box protein At4g21240	31.100%	Swiss-Prot	Medium
`Q9FZF8`	Arabidopsis thaliana	sp\|Q9FZF8\|FB44_ARATH Putative F-box protein At1g47790	28.900%	Swiss-Prot	Low
`Q9FK54`	Arabidopsis thaliana	sp\|Q9FK54\|FB260_ARATH F-box protein At5g18160	29.800%	Swiss-Prot	Low
`O49421`	Arabidopsis thaliana	sp\|O49421\|FB238_ARATH F-box protein At4g19940	30.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card