RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G193080
Reference: TK1151 Chr: Chr01 Coordinates: 49411286-49415212 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1659 bp · TkA01G193080|TK1151|cDNA

CCTCCCCCCACCCACCATTCAAACCCTAAATGCAACATCAAAACCATCATCCATGGGGGGTTGCATGTCTATTGCAAACGCAAGTTACTTAAGGAGATCCATTGTCCAACCTATAAAACCAGAAGAGCGCAAACCCCCAAAATTCATACGCCCTGCTCGCGTCCTCAAAGACTCTGCGGGAAACGCCATTTTCAAGCATTACAGATTTGGAAAAGAGCTCGGAAGGGGGGAATTTGGGGTGACGTACGAATGTCAGAATA...

CDS

Download CDS FASTA

1593 bp · TkA01G193080|TK1151|CDS

ATGGGGGGTTGCATGTCTATTGCAAACGCAAGTTACTTAAGGAGATCCATTGTCCAACCTATAAAACCAGAAGAGCGCAAACCCCCAAAATTCATACGCCCTGCTCGCGTCCTCAAAGACTCTGCGGGAAACGCCATTTTCAAGCATTACAGATTTGGAAAAGAGCTCGGAAGGGGGGAATTTGGGGTGACGTACGAATGTCAGAATATCGAAACAGGGGAGAAAGTGGCGTGCAAGAAGATGTCAAAAAGCAGGTTGAT...

Protein

Download Protein FASTA

530 aa · TkA01G193080|TK1151|PROTEIN

MGGCMSIANASYLRRSIVQPIKPEERKPPKFIRPARVLKDSAGNAIFKHYRFGKELGRGEFGVTYECQNIETGEKVACKKMSKSRLIAEIDVEDVRREVTIMRHMPVHPNIVSYKDVYEDKDAIYLLMELCEGGELFDRIVAKGHYTERAAALVIKTIVEVVQVCHTHGVMHRDLKPENFLYAHEGENAPLKAIDFGLSVSFEHGQRFREVVGSPYYMAPEVLKRCYGEEIDVWSAGVILYILLCGVPPFWAETEEGIAQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G193080
TK1151 IDTkA01G193080
OH-1004 IDLXL04_014493
Relationship / confidenceNon Reciprocal Best Hit / Complex relationship
Protein identity (%)72.800
Protein coverage (%)TK1151 98.491 / OH-1004 35.135
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G193080
LocationChr01:49411286-49415212 (-)
DescriptionSimilar to At3g28040: Probably inactive leucine-rich repeat receptor-like protein kinase At3g28040
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g12480 May play a role in signal transduction pathways that involve calcium as a second messenger. No verified direct reference in this release
At5g19450 May play a role in signal transduction pathways that involve calcium as a second messenger. No verified direct reference in this release
At2g31500 May play a role in signal transduction pathways that involve calcium as a second messenger. No verified direct reference in this release
At3g57530 May play a role in signal transduction pathways that involve calcium as a second messenger.
Arabidopsis calcium-dependent protein kinase AtCPK32 interacts with ABF4, a transcriptional regulator of abscisic acid-responsive gene expression, and modulates its activity.2005 · DOI: 10.1104/pp.105.069757

Rice

Reference gene IDPossible functionPapers / DOI
Os07g0568600 May play a role in signal transduction pathways that involve calcium as a second messenger. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_014493 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0035556 intracellular signal transduction Biological Process
GO:0048364 root development Biological Process
GO:0051302 regulation of cell division Biological Process
GO:0080092 regulation of pollen tube growth Biological Process
GO:0090511 periclinal cell division Biological Process
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0004672 protein kinase activity Molecular Function
GO:0004674 protein serine/threonine kinase activity Molecular Function
GO:0004683 calcium/calmodulin-dependent protein kinase activity Molecular Function
GO:0005509 calcium ion binding Molecular Function
KEGG gene cross-reference
ath:AT2G31500
ath:AT3G28040
ath:AT3G56370
dosa:Os07g0568600
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.503
Rank 1 · TkA01G193080 · TK1151
Cell membrane0.381
Rank 2 · TkA01G193080 · TK1151
Nucleus0.312
Rank 3 · TkA01G193080 · TK1151
Golgi apparatus0.051
Rank 4 · TkA01G193080 · TK1151
Endoplasmic reticulum0.045
Rank 5 · TkA01G193080 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase50-308 aa
PF07714PK_Tyr_Ser-Thr51-304 aa
PF14531Kinase-like54-103 aa
PF06293Kdo76-197 aa
PF03109ABC1124-207 aa
PF14531Kinase-like149-292 aa
PF13499EF-hand_7278-304 aa
PF25825SAPC2_N288-313 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA01G193080PF00069Pkinase503085.6e-77259.4
TkA01G193080PF07714PK_Tyr_Ser-Thr513041e-2797.8
TkA01G193080PF14531Kinase-like541033.4e-0524.0
TkA01G193080PF06293Kdo761970.0001122.4
TkA01G193080PF03109ABC11242071.8e-0524.8
TkA01G193080PF14531Kinase-like1492923.4e-0524.0
TkA01G193080PF13499EF-hand_72783046.4e-31107.2
TkA01G193080PF25825SAPC2_N2883131.4e-0525.6
TkA01G193080PF22592FCaBP_EF-hand2893030.003218.5
TkA01G193080PF28958LIN5_N3323670.2512.4
TkA01G193080PF10591SPARC_Ca_bdg3384144.4e-0524.5
TkA01G193080PF21805Imm5_like3383780.1512.7
TkA01G193080PF25825SAPC2_N3484141.4e-0525.6
TkA01G193080PF23564EF-hand_FSTL13504142.1e-0628.8
TkA01G193080PF30624EF_SSP1203533750.08714.2
TkA01G193080PF25578EF-hand_STIM13533780.5911.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q38873Arabidopsis thalianasp|Q38873|CDPK7_ARATH Calcium-dependent protein kinase 760.900%Swiss-ProtHigh
Q42438Arabidopsis thalianasp|Q42438|CDPK8_ARATH Calcium-dependent protein kinase 860.700%Swiss-ProtHigh
Q9SIQ7Arabidopsis thalianasp|Q9SIQ7|CDPKO_ARATH Calcium-dependent protein kinase 2461.800%Swiss-ProtHigh
Q6NLQ6Arabidopsis thalianasp|Q6NLQ6|CDPKW_ARATH Calcium-dependent protein kinase 3260.300%Swiss-ProtHigh
Q84SL0Oryza sativa subsp. japonicasp|Q84SL0|CDPKK_ORYSJ Calcium-dependent protein kinase 2062.100%Swiss-ProtHigh

JBrowse

View in Genome Browser