TkA01G131920 | RubberDandelionOmics

Gene overview

TkA01G131920

Reference: TK1151 Chr: Chr01 Coordinates: 33399102-33402547 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1539 bp · TkA01G131920|TK1151|cDNA

CCAAACTCCAAACAACTCAGTAAATAATGTATATGCTGTCAATACCAAATCTATGTTTTCTATATCAACGTTTATTCACAAGCGGATAGTAAAAGTTATGAAATATTAACCATGTGGCGTACCCCACTGTTTAGTACCAAGGACCAAATGGTAATTTGCTCCCTTCTCAGCTTGTAAAAATGTCGAAGAAGATTGTGCTGAAGAGATTTCCAACAAAGCTGAAGGAGCTTCTCGAAACCGGTTTGCTCGAGGGATTACCA...

CDS

Download CDS FASTA

927 bp · TkA01G131920|TK1151|CDS

ATGCTGTTGTGTGATTCGTGCATGGAATTAAAAGAATCTCAGCCTTCTCCTCAGCTCCTGGCCCAGTGTAGCACCAAACTACCTAATGATAGTAGCGATAGGTCAGCATCTCCAGTATCTGCTCCAATTTCAACTGCCCGAGTAGCCATCACTAGCACTGGCAGAAGCAAGGGCCAGGGAAGGCTAACCAGAAAAAACTGTTGGAGGGTTATAAAAAAGGGTGTGGAATCTTTTGCTTTTGCTGTAATAATGAGGTCAGC...

Protein

Download Protein FASTA

308 aa · TkA01G131920|TK1151|PROTEIN

MLLCDSCMELKESQPSPQLLAQCSTKLPNDSSDRSASPVSAPISTARVAITSTGRSKGQGRLTRKNCWRVIKKGVESFAFAVIMRSALHSLKLMLVGLHVANQCIVEAVPNGTWYCKYCQNMFQKEKFERNEDAVAAGRTASIESIEDIKRCIRVVQNFEPGEPGVPFPAKKGAPACVLCRAHDFSKTGFGPRTVIICDQGYFQALFSCIEELLASLNVKILALPAADKAESTWTNKLGFQKMPDLELKQYRRKYQVMVF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G131920`
TK1151 ID	TkA01G131920
OH-1004 ID	LXL04_004591
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.500
Protein coverage (%)	TK1151 66.883 / OH-1004 99.038 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G131920`
Location	Chr01:33399102-33402547 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_004591` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.408

Rank 1 · TkA01G131920 · TK1151

Nucleus0.373

Rank 2 · TkA01G131920 · TK1151

Mitochondrion0.175

Rank 3 · TkA01G131920 · TK1151

Cell membrane0.109

Rank 4 · TkA01G131920 · TK1151

Endoplasmic reticulum0.098

Rank 5 · TkA01G131920 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23250zf_DPOE_23-9 aa

PF23209IDM1_C84-123 aa

PF23250zf_DPOE_2110-130 aa

PF11781Zn_ribbon_RRN7111-122 aa

PF11682Zn_ribbon_11112-128 aa

PF11781Zn_ribbon_RRN7175-186 aa

PF11682Zn_ribbon_11177-186 aa

PF11781Zn_ribbon_RRN7197-204 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G131920	`PF23250`	zf_DPOE_2	3	9	0.63	10.5
TkA01G131920	`PF23209`	IDM1_C	84	123	6.2e-22	78.9
TkA01G131920	`PF23250`	zf_DPOE_2	110	130	0.63	10.5
TkA01G131920	`PF11781`	Zn_ribbon_RRN7	111	122	1.7	9.1
TkA01G131920	`PF11682`	Zn_ribbon_11	112	128	1.3	9.6
TkA01G131920	`PF11781`	Zn_ribbon_RRN7	175	186	1.7	9.1
TkA01G131920	`PF11682`	Zn_ribbon_11	177	186	1.3	9.6
TkA01G131920	`PF11781`	Zn_ribbon_RRN7	197	204	1.7	9.1
TkA01G131920	`PF23209`	IDM1_C	199	269	6.2e-22	78.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card